ZFIN ID: ZDB-TSCRIPT-131113-2545
Transcript Name: det1-201
Previous Name: det1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056397 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056397|OTTDARG00000039283|ZDB-GENE-030131-2809 det1|OTTDARP00000044218 det1-001 LG_ CU571064.7 Danio rerio protein_coding KNOWN, 2057 bp
CTTTTAAACAATACCTAAACTGCATTTTCAAACGTCTTTG
CTCTAATGTTTTGTGTAAAGCTGGTGTATGTTGTCTCTTA
GCCCTGCTCGTGCTGTCAGTGAGTTGAGCTGCACAGATTT
TAACATGACAGAGTTTTAAATGAACATGCAGTGATAAAGC
TGTTATTATGGCTGCTCACCACCACCTCCACCACCACAAC
ACATCAGAAGACGATTTCCCCACTCTCAAACCAAGACGCA
TCCAAAACCAGAATGTGGTCCACCGGCTAGAAAGGCGTCG
GATCTGCTCTGGCCCGGTCGGTGCTCACTGGTACCGCGTG
CGCTGCTTCCACCAAAACCTGTTTCCCAACTTTACAGTAG
TGAACGTAGAGAAGCCGCCCTGCTTCCTCCGCAAGTTCTC
TCCTGACGGACGATGCTTCATTGCGTTCTCTTCCGATCAA
ACTTCCTTGGAGATCTACGAATACCAAGGATGCCAAGCCG
CCGAAGACCTTCTCCAGGGTCAAGAGGGAGAAACTCTGGC
CAACGGAAATGACCAGCGTTCCTTCAACATCAGAGGTCAC
CTCTTCGAACGCTTTTTCTCTCTACTTCACGTCACTAATG
TGGCCTCCAACGGCGAGCACTTGAACAGAGAATGTAGTCT
TTTTACTGACGACTGTCGTTATGTGATCGTCGGCTCGGCT
GCTTATTTACCTGAAGAACCTCATCCGCACTTTTTTGAGG
TGTATAGAAATAATGAATCAGTGACTCCCAATCCAAGATC
TCCTCTGGAGGACTATTCTCTGCACATCATAGACTTGCAC
ACGGGACGGCTGTGTGATACACGCACCTTTAAGTGTGACA
AAATCATTCTATCGCACAACCAAGGACTGTACCTGTACAG
CAATATTCTGGCCGTGCTTTCTGTGCAGCAACAGACGATA
CATGTGTTTCAGGTGACATCAGAAGGCACCTTCCTGGACG
TGCGCACCATTGGTCGTTTTTGTTACGAGGATGACCTGCT
TACTCTTTCTGCTGTTTACTCCGAGGCCCAAGCTGAAGGT
CAGCCCGGCTTCTCTCGCTTATACAAGGAAAAAACCATCA
ACTCCTTAAAGCACCGTCTGCTGGTGTACCTCTGGAGGAG
AGCAGAGCAGGACGGCAGCGCCACAGCCAAACGCCGCTTC
TTCCAGTTCTTCGACCAGCTCAGACAGCTGCGTATGTGGA
AGATGCAGCTTCTGGATGAGCATCACCTGTTCATCAAGTA
CACCAGCGAAGATGTGGTCACGCTAAGAGTCACCGATCCT
TCTCAGCCCTCTTTCTTCGTAGTCTACAATATGCTAAGCA
CAGAGGTCATTGCAGTTTTCGAGAACACTTCGGACAAACT
TCTGGAGCTTTTTGAAAACTTCTGCGATCTCTTCCGGAAC
GCCACTCTTCACAGCGAGGCTGTGCAGTTCCCCTGCTCGG
CTTCCAGCAACAACTTCGCCCGCCAGGTGCAACGCAGGTT
TAAAGACACCATCGTGAATGCCAAATACGGAGGGCACACA
GAGGCAGTCAGGAGGCTTCTCGGGCAGCTGCCCATCAGTG
CTCAGTCTTACAGCAGCAGCCCGTATCTGGATCTCTCCCT
CTTCAGTTATGATGACAAGTGGGTGTCTGTCATGGAGCGG
CCCAAGACCTGCGGAGATCATCCCATAAGGTTCTACGCGA
GAGATTCTGGGTTGCTGAAATTTAAGATCCAGGCAGGCCT
GCTGGGAAGACCTATTAACCACACCGTCAGGAGATTGGTC
GCTTTCACCTTCCACCCCTTCGAGCCCTTCGCCATCTCCG
TGCAGCGAACCAACGCCGAATACGTTGTCAACTTTCACAT
GCGGCATGGATGCGTATGATAATGCATGCGTGAGTACTGA
CTTGCGATTTGAAAGACTTTTTTTGGTTCCTTTTATGCAT
CTTTTTTATATTAAAGTTTTATTTATTACAAATGTGATGT
GTATTTACACTAAGTGTTTTTATATGTGGATTTTCTTTTG
TTTTACCCAATTGCAACATGCAAAATAAAACGGGTTTGTG
ATACTTATGTTACAGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
det1-201 Contained in:
[BAC] CH211-280A23 (1)

Genome Resources: Vega_Trans:OTTDART00000056397 (1),  Ensembl_Trans:ENSDART00000168275 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC055677 (1) 2095 nt
GenBank:BC076520 (1) 2080 nt
GenBank:BC164661 (1) 1759 nt
CITATIONS (2)