ZFIN ID: ZDB-TSCRIPT-131113-2525
Transcript Name: sv2-201
Previous Names: sv2-001, dkey-279i2.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056333 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056333|OTTDARG00000039245|ZDB-GENE-000607-80 sv2|OTTDARP00000048648 DKEY-279I2.1-001 LG_ AL929134.21 Danio rerio protein_coding NOVEL, 1795 bp
CTTCCGCTTTGCGATCATGTAGTTTACACTCGTAATTCTT
TGATTATAAATATTAATATGCCTCGACAGTCTCGTGAGGA
TACAGAACCTCTGCTATCGTCCGCTAATAATGAGGAAGAC
GATGAGCAGGCGTCCTGCAGAAAGAAACTTACATATGAGG
AGGCTGTTGAGAAAGCAGGGTTTGGTCTCTTCCATTGGCT
GCTGTTGGTAGTCTGTGGATGGGCAAACGCCAGCGATGCG
GTGGAGATCCTGTGTGTGTCGTTCCTGCTGCCCACGGCCC
GCTGTGATCTCCAGCTCAGCTCGGCCGACATGGGCATCCT
CACCGCCAGCATCTTTCTAGGGATGATGGTGGGCGGTTGT
GTTTGGGGGTTTCTGGCTGATCGCAGAGGAAGGCGGAGCG
TCCTGGTGGTTTCTCTGGCTGTCAATGGCACATTCGGGGC
GGTGGCCAGTTTGGCACCAACTTTCTGGCTCTTTCTGCTC
TTGCGGTTCTTCAGTGGAGTCGGGGTCGGCGGCTCCATTC
CTGTCATCTTCTCCTATTTTTCGGAGTTTCAGCCGTGTTT
GCGGAGGGGGGCGATGATTAGTGCTCTGGCAACCTTCTGG
ATGGCTGGAAATATTTTAGCTGCAGGTGTGGCGTGGCTGG
TGATTCCCAGGACATCTCTGCATGCTGACTGGGGCTGGTT
GGATTTTCAGAGCTGGCGTCTTTTTGTGGTCCTCTGCTCG
ATTCCCAGTCTGTCATCAGCACTGATTTTCAGACTCTTCA
TGCCGGAGAGCCCAAAGTTCCTCATGGAGGCCGGACGTGA
GATGGAGGCTTTGTCTGTGTTCCAGAAGATATACAAACTG
AACAACAGAGGTGCCACAAAACCATTTCCTGTATCAGGGC
TCATGATCAGACCTAAAGATGATGAAGTGAAAAACAGACC
CAGCCACAGCAGCTCAAGATCACAGCGCTTCATCAATCAG
CTCACACAGGCTCTGGTCCCGCTGAAACAGCTGTTTGTCA
GACCGCTGGCTTCCAGAAGTGTCGTTCTAGTGATCATCTT
TTTCTGCATCTCATTTGGGTATTATGGGTTATGGATGTGG
TTTCCGGAGCTTTTCAAGAGGGCAGAAGATGGAGGTTCTC
CATGTGCAAACATGTCTCGAGCCCAAAACGCAGAGAACGA
AAAGTGCTATCCAGTCAAAACCGCAGTGTACATGGAGGGG
TTTATAACGGCGGCTTCAAACTTGCCAGGAAACATCTTCA
CTATTCTCCTCATGGACAGAATCGGCGGGAAAATCCTTTT
ATCCGTTAGTTTGCTGGTGTCCGGCGTGAGTGTGTTCGTC
ATTTACGTGGTGAAGACTAAAACTCAGAGTCTGATCGTGT
CCTGTGTGTTCAGTGGTGTTTCTGTCATCTCCTGGAACGC
TCTGGATGTCGTGGGGACAGAACTTTACCCTACACAACTA
CGCTCCTCGGCTCTGGGGGTCTTCACTGGAGTGGGTCGAG
TGGCAGCCATCATGGGCAATGTGGTTTTCGGGCAGCTGGT
GGACTCGAGCTGTGCCGTTCCTCTGCTGATGGTGTGTGTG
CTCCTGCTGGCGGGAGGACTGGCAGCTCTGTGGCTGCCTC
AAACTAAACAGACTCAACTCACATGATGCACACACACACA
CACATAGGCATTAAAAGAGATACAGTTGAAGTCAAAATGA
TTAGCCTTCCTGTAAATTATTTTGTCTTCAAATATTTCCC
AAATGATGTTTAACAGAGCAAGGAATTTTTCAGAGTATTT
GCTAGAATATTTTTTCTTCTGGAGAAAGTCTTATT

sv2 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript sv2-202 (1)    Ensembl 1594
mRNA sv2-201 1795
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sv2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056333 (1),  Ensembl_Trans:ENSDART00000128816 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124724 (1) 1854 nt
CITATIONS (2)