Transcript

pgfb-201

ID
ZDB-TSCRIPT-131113-2397
Name
pgfb-201
Previous Names
  • pgfb-001
  • dkey-204k5.1-001
  • si:dkey-204k5.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055743 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055743|OTTDARG00000038874|ZDB-GENE-131127-445 pgfb|OTTDARP00000043706 DKEY-204K5.1-001 LG_ BX511263.7 Danio rerio protein_coding PUTATIVE, 1608 bp
GGAGATTTAAATGATGAACTTGTTGAAAGGTAGTCAGGGC
GCTCATGTGGAAGTGTGCCACTCTATTTGGGAAAGCAGGA
AGCACGCAAACTGACGCTGGAGCTCCAGAAGCGCGCAAGG
ACCTTTAAAACCTGCAAACTGTAACTGCAAACACTGGACA
TTGCATAAGGACTTATTTAAAACACTTTACCACGTGCATT
TACTACAGGGAGCGGTAGATTGGGTGCAATTACGTGACGT
GTCACAGCTGTTGAAAATATTAAATTTAAATTGTTTAATT
TAATTTGAGAAAACCTCCGACAAGGAAGACGCAATTTGGA
CATTTAGAATCGTTTTGTGGAATAACTGCTGAAATTGGAT
GGACTATTCGGGCGGACTACTGTTTGGATTTTCCTTCAAT
TAAACTTGTCTTGGCGTTCGAGATGAGTTATTTGACGTCA
CTGTTACGAGTATTTGCCGCGGTGCAGTTGAGCCTTTTAC
CTGGACAGAGTTCTTCGTTGGTCAATGTAAACAGCACTGA
TAAAGTGATGCTGTTTCAGGAGGTTTGGGGGAAGAGCTTC
TGCCGCACTATAGAGAAGCTGGTGGAGGTGGTTCAGGAGT
ACCCAGGGGAGGTGGAGCACATTTTCAGCCCCGCCTGCGT
GCCATTGGTCCGTTGCGCTGGTTGCTGTGGCGATGAGAAT
CTGGAGTGTCACCCTACGCTCACTTCCAACACCACCATGC
AATTATTAAAGATTAAGCCAGCAGAGCAGGGCCAGGAATA
TGTGGAGATGACCTTTGTGGAGCACAAAGCCTGTGAATGT
AGACTAAGAAAACCTACAACAAAACAAGACAGATGGAAAC
CCAGAAATAGAGGGAGAAAAAGGAAGGAGAAGCAGAAAGC
CAAAGACTGTGACCGGTGTCAGCCTCCCCGCAGGTAAACG
CTGTCTCGCCATGATGCCAGTCAATCACGCGCATCCGCCC
CTCTCTGTGCGACCCTCACCATGGTCATCATTCACTCCTG
GATCCCGCCACCTCTCCACACTCCTCGATCCAGGCGCAGA
GCTGTAATGGTAGAGGGGCTTCTGTCAGCACACGGGGGAG
CTTCCAGTCATCCATACCGAAAAACTGCTGCACAGCTCTT
ACTGAAGAAAAAAACAAAACAAAAAACAACAGCAGGAGAC
CAAACTTAAAATCTTAGACTGACGTCAACCCTTTGGACAT
TATCATAATAATATAATAAGATAATTATTTTATTGTTTAA
TAGTAATATTATTATTAGTAGAAGTAGCATAGTTACAATA
GCGACCAGTCTTCCCTCTTATTTATTAAAATCCGCTGAAG
TAAAACAGCTGCATTCCATGATTAGGGATCAACAAAGGCA
TTGTGTATTTGGAAAGAAGTCTAGAAGGAATCACACAATG
AAAATGCCAAAGATGTTTTCATCTCTTTACTGCTATGCAA
ACTATATTACCCTTTAATTAAGCGAAAACCTCGTCAGACG
CTCATACGTGATGCTGTGGTTAAAACTCCAGACTAGAGCT
TCTGTGTGAGTTTAGCACTATGGCAAGCCTTTTTAGCATT
CATTTTCCTTTGGCTTAATGCCTTATTTATCAGCAATCAC
CACAGCGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations