Transcript

si:ch211-160f23.5-201

ID
ZDB-TSCRIPT-131113-2361
Name
si:ch211-160f23.5-201
Previous Names
  • ch211-160f23.5-001
  • si:ch211-160f23.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055623 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055623|OTTDARG00000038783|ZDB-GENE-030131-704 si:ch211-160f23.5|OTTDARP00000043618 CH211-160F23.5-001 LG_ AL935033.5 Danio rerio protein_coding PUTATIVE, 2871 bp
CGCTGCGCGCCTCTAACCGCGGGAGATCCAAATTTCGCGG
GACGTAATTTGGCGCTAAAATAGCACTCCTCTGTTGAGCT
GATGTCAAAGCAAAGCTTTTCTGCTGGAGAAGGATTACAG
ACACACAGGGACCTTTCTCACGGTCACTGGCTTTACTCGA
TAACTGCGAGAGGAACATTTTGAAGCTTTACTTATCATTG
AAAGGTAGTTTTATCAAGCATTGTGCGTGTAGTATATGTT
TAAGTTATTTTCATTATAACAAAACAGAATAGCTTCTCCT
GTGCTACAACAACAAAGGACCCTGGGATACTTTGTGCAAC
TCGGATGATTATATTTTCTTATTTTCACGCGTAATTTATC
TGCAACTTTAACATTATTTATTATACTAATATTGCAATAT
ACTATTATACAACTATCGCTTGTAGCATTAGCATTGTTTT
AAGATACACGTATTCATTAACGCTTGATTGGTTCTGCAGT
GAACTACAAACGCAATTTGCGTAATAAAAGAGTTTCTTTT
GCGTCACTTTCGCGGGTTTTGCATTCCGTGCGCAAAATGA
TGCGGATACCCAGAGGGATTTCTCCTGCTTCGGGAAGAGG
CGCAGGAACTGCACTCTCGTGCCCGCAGAAGAAAATGTTC
ACCGCGATGAGGACGGACTTTTTCACCACGGGACTGGCAA
GTCCACCGATGAATTCGGTACCGGCTGGATACTTCACTCA
GATCGGGAACACGACAGCTGTGGAGCAGAGACCCAACTGT
TTGTATGCGACCCCCCACGGGCCCGAGCCTAAGCCGGTGC
GGACTTCTTCCGGGCGGCTACCGGCCAAGAGGAGACTAGA
TCTGGAAGAACCACTTTATCTCCCAGAATTTCGAACTCCA
AAAGGGAAAGGAAATGCTGCATGTGCGAGAGCATCAAGCC
CCAAAACTCCTAAATCTCCAGGAGAACGCACCCGTTACGA
TACATCCCTTGGCCTGCTGACTAAGAAGTTTGTGGGCTTG
CTGAGTGAATCTGCTGATGGGGTTCTGGATCTAAACTGGG
CCTCAGAGGTTCTGGAGGTTCAGAAGAGACGCATCTATGA
CATCACCAATGTTCTGGAAGGAGTGCAGCTCATCCGCAAG
AAATCCAAAAACAATATCCAGTGGCTGATCAGTGGTGTAT
TTGAAGGTTCGTCCAGCAACTCGGAGAAAGCCAGCGCTCT
CAATAAAGAGCTCTCTGAACTGGACAGACAGGAGAAAGCT
CTGGACGATCTCATTCAGTCCAGCTCAACACGACTACGAG
AAATGACGGAGAGCAAGGACAACCAAAGATTAGGGTATGT
GACGTATCAGGACATTCGTACCATAACCAGCTTGAAAGAT
CAAACTGTGATTGCTGTCAAAGCACCATCTGAAACCAAAC
TGGAAGTTCCAGAAGCGTCCGAGGGCTCTCTGCAGATTTA
CTTGAAGAGCAAGAATGGCCCTATCGAAGTGTACTTGTGT
CCTGAAGAGTGTTTGGAGTACACTAGTCCCATCAAGAATG
CCACACCCAGAAAAGATTACCCACAAACCCCCAGTGCCAC
CACACCCTCCGTCTTCCCACCTGCAAAACCCCAGTCTGTC
GAAGGTCCAAAGACTCAGCCCTCGATGGCAGCGAGCACCA
GTGGAAACGGCTCTCTTTTGGACGTGGAGGGCATTCTGGA
TCTTCCTCCTAGTCTTCTGCAGATCACAGAAGACCAGCTG
CCCGGGATGGCCTTCGCATCTGACCCCTCTGGGCCCTTTG
TCAGTTTCTCTCCTCAGCTCGGCCACGATGACTACCTCTG
GGGTCTGGACGACGGAGAAGGCGTTTCAGACTTTTTTGAC
ACTTACGACCTGGGAGATCTGCTCAAAACATGAAGCGTTC
AGTGTGATGAACAGTCACTGATGATCTGAGAGTTAAATTA
TAATTAGTTCAATTCAGACCCAAATCCTGTAGTTGAAGAC
TGTTTCTAAAACACTTCTTGATGATAGATTGAAGTTTGTA
TTAAATGCACTACTGAATTGGCTAGGATTAAGTGAATGTC
TATTTTGAAGGGATAGTTCACCGAAAAAAAATTAAAATTC
TGTCATTTATTAATCCTCAAAGGTTCTTGTTTCTGTTGAA
CACAAAAGTAGATATTTTGAGGAATGATGAAAGCCATCAA
CATCCATAGTAGGAAAAAACACTGCTGTTTACAGCTTTTA
TTTATAATATGCTCTTTTGTGTTCAACAGAGGACAGAAAC
TGAAACAGGTTTAGATCACGTAGAGGACTAAATGGTGACA
GAATCATCATTTTAATGGGTGAACTATCCCTTTAACTACT
ATAGCGATTATAATCTTGACGCCCTCTAGAGGAGATCTGG
GAGTTAGAATTAGTACACTATGAAGCCATATGTTTTTTTT
TCTGTCAGCCATATTACCTACAGCAAGGTATTTCTGCCTG
CATAGTTTAGTTTAGAATATTTTTGACAAAGCTCAAATTC
ATTTTCTCAAGTTGTTTTTAATTATTTCAATTTTCTAATT
TAATTATTTGCTAAGATTTTGGTCATTATGACTTAAGCAT
TGACCAAAAATCAAGTGCTAGGTGCTTGTGTTCTCTAGGT
ATGAACTAGAATGTTTATTAGTATTTGAATTAGATGCAAC
TCAGGTCATTTTAAAGCTTTTCCACAGCTTTATTTTTGTA
GTACTGTCAGTCATCGCCAGCAGAGGGCAGTGTGACCATT
TTTCAGACGTCTGCAAACAAAGGTGCCTCTGCAGATGTAG
ATAGATGAAAGTATTAGAGTTTGAGAGCATAAAAATGGTG
GGTATCTGCTTCAAAATCAGACTCAGAGTGCTGAAAAACT
CTTCTAAGACATTCTACCTCCATCTTTTGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations