Transcript

si:dkey-18b8.8-001

ID
ZDB-TSCRIPT-131113-2347
Name
si:dkey-18b8.8-001
Previous Names
  • dkey-18b8.8-001
Transcript Type
lincRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000055564 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055564|OTTDARG00000038755|ZDB-GENE-131127-315 si:dkey-18b8.8|no_translation DKEY-18B8.8-001 LG_none BX324186.12,CR788235.9 Danio rerio lincRNA NOVEL, 896 bp
ACAGTCTTTTTTAAAAGCGCTCTGAAAACAAACACAGAGG
CCGGACCGCCAGCTTTAGGACCTACACCACAGCTCTGGAC
ACAGCAGGGAAGCTGGGATTTTGAGGATGTCAAGATCTGG
ATTAGCCGTACCATGAGGAAGTCACATGAAGATTTTTTAG
ATGCAGCGAACCAGCCATCCTTCACCTCACAAACGTCCGG
GATATGGGTCAAACAGGTGTCATCCTGAAAGTATTTGGAC
ACAATTGCATCAGACCAAAATGTATTTTCTTTGCATCATT
TACAGAATATAAAAACAATTGGTATTTTCTAACTTTTTTA
AGGATCTCACTTTCCTGTAACTTTTGTGCATTTATTTATT
CATTTATTATATATTTTTTTCTTATCAGTCACAAAGAGTT
AATATCAACAGTATATCATATGATTTTAACTCCAACTTGT
CCTTGAAGTTCGCCGTTTGGTTCATCTTTAAAACAAGTTC
CATTTATGTCATGCTTATGAACGGCAATTGTTTTAAAGAG
TGGCTTAAAGTCTCCATGTCTATATGGAATCAGTGCACAT
ATAGCTTGATCTCACAAGAAAATGCAAGTATTTTTATGTT
TTGTCAATTTAGTGGCTAATTCTTATGATTTTTAAAGGGA
TGCTCTGCACCCAACCCCAATCCTAAACCCAACTGTCATC
GGGGGATGAGCAAATTGTACTAAATTGTATAAATGAGATC
GTACAATTGCACATTTCATATGAATTAGCCACTAAATCAA
AAAGTTACGAATTGCTGTGAGATTGTGTTGGCACATTTCA
CAAAACCTCTAAAAAATGCTGGGTACCACACAAATAATTT
GTGATGGGACAACATATTGGAATTAAATTTACATTTTAGC
TTTTACAAATGTAAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations