Transcript

htr1d-201

ID
ZDB-TSCRIPT-131113-2345
Name
htr1d-201
Previous Names
  • htr1bd-001
  • htr1d-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055558 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055558|OTTDARG00000038750|ZDB-GENE-090409-3 htr1d|OTTDARP00000043574 htr1bd-001 LG_ BX088703.5 Danio rerio protein_coding KNOWN, 2633 bp
GAAGACCGCCGGACGAAACGGGACAGTGTACTATTGCGTA
GGCTACTCGTCGCTTTGCACTAAAAGAGAAATATTTATTT
TCTTCTCAGGTGTTGAGCACATTCTTTCTCCGCTTTTTAT
AACGATATACGCTGTAAAGTGTCTTTCCACATGGCTTAGG
AGTCTCCTGTAACTATGCGCGATTTTTAACCACACACATC
GTGCTGGATAAGGCGCATCGCAGTTTGTCTGACCTTTACC
ATTTAAAGGTAACACTTATTTTGGATACTCGACTTGATGA
CTTCGATTTGAAGACTCGCTCGTGATGAAATGATGGAATT
CTGCAACTTAAGTTTGATCTTCACTTGGATTGATTTCTTT
CATCTGGACTAACACCTACACAGGGCCAAAACGAGAACTT
TCAACAGCTTTTGGTGTTCAGGGAAACTGCAAAACCAGCC
ATCCGTGGATGTACAGGGAATGAAGGAATATTCTGTGCCA
TTAGTCTGAAACAACAGAGCTTCTGCTGACCAACTGGAGA
ATAAATTAAAAAGTCTTCCACCAGTTCATATTACCCAAAA
TTGAGGGATCTCCCATTAAAGAAGAATAGCAGAATAAGGA
ACAATAAAGAAAATAATGAGCAGTGATTTAAGGGCTAAAG
GAATATTTTTATAACTTAAGTCAAGTACAAAGAATAACGC
CGGACCCTTGTTTGTTCTGTGGCATTTAACTTGCTGGGTT
TCAAAAACAAAGCAAAAAGAGCACAAAAAGAGTAACAGCA
CCTTCAACCATGAATTACCACTCACATTTATCAGCCATGA
CCTTCACAAATGTAAAGCATTACCAATATCTCCAACAGCC
GAACTAGAATTACTCTTTCACCTCGAGATGTTTTCATGGG
ATAATTAATCCTTAACACCAAAAAAATCATGCATAGATGA
TGTGAAGCGCTGCTGAACCATGCAACATGGATCTGTTCAA
CAGCTCCGATGAGTTTTTCCTCATCAATGCCACAGTCAGT
CCCACAACCCTGGAGTCCTGGGACGACGCCACGCTCCTCA
GTCTGCAGATCTCCATCTCTGCCATGCTAGCAATCGTCAC
TTTGGCCACAGCTCTGTCCAACGCTTTTGTAATCGCCACG
ATTTTCCTCACACGCAAGCTTCACACCCCTGCCAACTTCC
TGATTGGCTCTCTCGCAGCGACAGACCTCCTGGTGTCCAT
TTTAGTCATGCCGATCAGCATCGTCTACACGGTCAGTAAG
ACTTGGACTCTGGGTCAGATTGTGTGTGATATCTGGCTAT
CATCTGATATAACGTTCTGCACGGCCTCCATCCTGCATCT
ATGCGTGATCGCGCTGGACAGATACTGGGCCATCACGGAC
GCCTTGGAGTACTCGAAACGGAGAACCATGCGGCGAGCAG
CGTTGATGATTGTCATAGTATGGGTGATCTCCGTCTCTAT
CTCTTTACCTCCTCTATTCTGGCGGCAGGCGAAGGCTCAT
GAGGAGCTCACGGAGTGCATGGTCAACACCGACCAGATCT
CCTACACGCTCTATTCCACATTTGGCGCCTTTTATGTTCC
CACGGTGCTCCTAATGATCCTCTACGGGCGTATCTATGTG
GCAGCTCGCTCCAGGATCTTCAAAACACCGGCGACCAGCG
GAAAGCGCTTCACTGCTGCTCAGCTCATCCAGAACTCGGC
AGGCTCTTCGCTTTGCTCGCTGAACTCCACTTCTAATCAG
GAGGGACATCTTCATGCTGGAGGAGGAGGAGGTAGTGGTG
GTGGTGGAGGAGGAGGAGGAGGGTCTCCTCTTTTCACGAA
CAGTGTGAAAGTGAAGCTGGCTGACAGTGTGCTAGAAAGA
AAGCGTCTTTGTGCTGCTCGGGAGAAGAAGGCCACCAAGA
CTCTTGGGATTATCCTGGGTGCGTTTATAGTGTGCTGGCT
CCCATTCTTCGTGTTTACGCTGGTGATGGGTGTCTGTAAA
GACTGCTGGTATCATCCTGTGCTCTTTGATGTGTTCACCT
GGCTGGGATACCTCAACTCGCTCATCAATCCAGTCATCTA
CACTGCCTTCAACGACGACTTCAAACAAGCCTTCCACAAA
CTCATCAAGTTTAAAAGATGCTACTGATGTTACGCATCCC
TGCCCTGTGTTGACACCTTCACTACTTAATTAGCGGATTT
CTGCAGAAAACACCTGAATCCTGTGAACATTTGTCTGTCA
TATGATGTGGAGGAGCCAATGTATCCCAATGTTAGTTTTT
CAGTGAGCTCCTAAACACGCACATAGTGTCCGGTCGATGT
AGATTACTGTTCTCATGAGACAGCTTGTAAAATATTGTGC
CATATTGTTGATGCTTCCTTGTAGTTTAAGAATGCATGCT
AAGATTACCAATCCTTCGCTTGAGAGCAATGTTCTCTTGT
CTCTGTAAACAATAGCTGTCTATAAACTGCTTTAATGACC
AGGAACAGACTGAAATCAAATTGAGACTTTATTTAAAACA
GATATAAATAAATGAAGATTGGTGCTCCCATGGGAACACA
TACAGTACCATATATATGGGCCATGGAGGACCATGCTGAA
GATCACGGACATTAGCCTAGCCTCCCTAAATAAAAATGTT
CATTACATAATATTAAAAAAAAGAAGCTTTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations