Transcript

abhd17aa-201

ID
ZDB-TSCRIPT-131113-227
Name
abhd17aa-201
Previous Names
  • abhd17aa-001
  • ch73-182h3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050096 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050096|OTTDARG00000035240|ZDB-GENE-030131-840 abhd17aa|OTTDARP00000039325 CH73-182H3.1-001 LG_ CU929316.8 Danio rerio protein_coding KNOWN, 1552 bp
CGACAGATGAAAACATCAGTGTTGGGTGCTAAAGCCCGGC
TGATTCCTGCCACAATCAGGAAGATGTTTACCATCCTACT
GCCTTTTTCCAATAAACACGGATCAAACAGTTAGTGTTTA
CTGCATCTCTAGGTAGCTAAAGCCCATTTTGTGTTACAGT
ACCCTTTTTGGTTCTCTGAATTCAAGAAGGAGAAAATGAA
CGGCTTGTCCATCAGCGAATTGTGCGGTCTGTTCTGTTGT
CCACCCTGTCCGAGCCGGATTGCAGCGAAGCTGGCCTTCC
TGCCTCCTGAACCCACCTATGCCCTCCTGCCAGACCTGGA
GTCCTCTTCTCCTGTTACCTCTAACCTTGGAGCCTCGGGT
TTGCGCTCTCGCTTGGGTGGAAATGCTGGAGGTACCGCAG
GAGGAGGTGGAGGTGGTAGCGGTGATGGTGGTGGAGGAGG
AGGAGGTGGTTTTGCTGACAGAAGTGGTGAAGGCCGATGG
AAGCTGCATCTGTCTGAGCGAGCAGAGTTCCAGTACTCTC
AGAGGGAGCTGGACGGCACAGAGGTCTTTCTCACTCACTC
CAGCCGTGGAAATAGAGTAGGCTGTATGTACATCCGCTGT
GCCCCGTCCGCAAGGTACACTGTGCTGTTTTCTCATGGTA
ATGCTGTGGATCTCGGTCAGATGAGCAGCTTCTATATTGG
TCTGGGCACTCGCATCAACTGCAACATTTTCTCTTACGAT
TACTCCGGTTATGGGGTCAGCACAGGGAAACCCTCGGAGA
AGAATCTGTATGCAGACATTGACGCTGCATGGCACGCTTT
GCGCTCAAAGTACGGCATCAGCCCGGAGAATATAATCCTT
TATGGGCAGAGCATTGGCACTGTGCCCACCGTGGACCTGG
CATCTCGTTATGAGTGTGCTGCTGTGGTACTTCACTCACC
TCTCACCTCGGGCATGAGGGTTGCGTTCCCTGACACCAAG
AAGACCTACTGCTTTGACGCCTTCCCAAACATCGAGAAGG
TGTCTAAAATCACATCTCCTGTGCTGATCATCCACGGGAC
GGAGGACGAAGTGATTGATTTCTCTCATGGTCTGGCCCTG
TTCGAGCGCTGCCCGAAAGCAGTGGAGCCGCTGTGGGTTG
AAGGAGCGGGTCATAACGACATCGAGCTCTACAGCCAGTA
CCTGGAACGTCTGCGCAGGTTCATCAGCCAGGAAGTGGCT
ACGCAGTAAAAGCTGGGACACTTTTTCTTTTTGTGCTTGC
GTCAATAAATAGTCGGCCATGTGTGGAAAGCAAACACACC
GAGTTATTTCTGGAGGGTTTGTTTTTCTGTAGATGTGCCG
GCTGTTTGGTTTCTATCAGCCTGGAGCTGAGTTTTCTACT
GAGAAGTCTGAAGGTTTCACACGGAGAAGATCTGGATGTG
TGAGCGTCGGGTCTCAGGAAGGACCTCAGTCCATCTGAGG
CGCTCGCTCACTTGATTTGGCTTGTGATTTATTATGATTC
TTTTTCTTTGTGATTTAGGACGACTGAAGTGTCATTTTGA
ACATGACTAATATCTAATATCTGGTAATGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations