ZFIN ID: ZDB-TSCRIPT-131113-227
Transcript Name: abhd17aa-201
Previous Names: abhd17aa-001, ch73-182h3.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050096 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050096|OTTDARG00000035240|ZDB-GENE-030131-840 abhd17aa|OTTDARP00000039325 CH73-182H3.1-001 LG_ CU929316.8 Danio rerio protein_coding KNOWN, 1552 bp
CGACAGATGAAAACATCAGTGTTGGGTGCTAAAGCCCGGC
TGATTCCTGCCACAATCAGGAAGATGTTTACCATCCTACT
GCCTTTTTCCAATAAACACGGATCAAACAGTTAGTGTTTA
CTGCATCTCTAGGTAGCTAAAGCCCATTTTGTGTTACAGT
ACCCTTTTTGGTTCTCTGAATTCAAGAAGGAGAAAATGAA
CGGCTTGTCCATCAGCGAATTGTGCGGTCTGTTCTGTTGT
CCACCCTGTCCGAGCCGGATTGCAGCGAAGCTGGCCTTCC
TGCCTCCTGAACCCACCTATGCCCTCCTGCCAGACCTGGA
GTCCTCTTCTCCTGTTACCTCTAACCTTGGAGCCTCGGGT
TTGCGCTCTCGCTTGGGTGGAAATGCTGGAGGTACCGCAG
GAGGAGGTGGAGGTGGTAGCGGTGATGGTGGTGGAGGAGG
AGGAGGTGGTTTTGCTGACAGAAGTGGTGAAGGCCGATGG
AAGCTGCATCTGTCTGAGCGAGCAGAGTTCCAGTACTCTC
AGAGGGAGCTGGACGGCACAGAGGTCTTTCTCACTCACTC
CAGCCGTGGAAATAGAGTAGGCTGTATGTACATCCGCTGT
GCCCCGTCCGCAAGGTACACTGTGCTGTTTTCTCATGGTA
ATGCTGTGGATCTCGGTCAGATGAGCAGCTTCTATATTGG
TCTGGGCACTCGCATCAACTGCAACATTTTCTCTTACGAT
TACTCCGGTTATGGGGTCAGCACAGGGAAACCCTCGGAGA
AGAATCTGTATGCAGACATTGACGCTGCATGGCACGCTTT
GCGCTCAAAGTACGGCATCAGCCCGGAGAATATAATCCTT
TATGGGCAGAGCATTGGCACTGTGCCCACCGTGGACCTGG
CATCTCGTTATGAGTGTGCTGCTGTGGTACTTCACTCACC
TCTCACCTCGGGCATGAGGGTTGCGTTCCCTGACACCAAG
AAGACCTACTGCTTTGACGCCTTCCCAAACATCGAGAAGG
TGTCTAAAATCACATCTCCTGTGCTGATCATCCACGGGAC
GGAGGACGAAGTGATTGATTTCTCTCATGGTCTGGCCCTG
TTCGAGCGCTGCCCGAAAGCAGTGGAGCCGCTGTGGGTTG
AAGGAGCGGGTCATAACGACATCGAGCTCTACAGCCAGTA
CCTGGAACGTCTGCGCAGGTTCATCAGCCAGGAAGTGGCT
ACGCAGTAAAAGCTGGGACACTTTTTCTTTTTGTGCTTGC
GTCAATAAATAGTCGGCCATGTGTGGAAAGCAAACACACC
GAGTTATTTCTGGAGGGTTTGTTTTTCTGTAGATGTGCCG
GCTGTTTGGTTTCTATCAGCCTGGAGCTGAGTTTTCTACT
GAGAAGTCTGAAGGTTTCACACGGAGAAGATCTGGATGTG
TGAGCGTCGGGTCTCAGGAAGGACCTCAGTCCATCTGAGG
CGCTCGCTCACTTGATTTGGCTTGTGATTTATTATGATTC
TTTTTCTTTGTGATTTAGGACGACTGAAGTGTCATTTTGA
ACATGACTAATATCTAATATCTGGTAATGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abhd17aa-201 Contained in:
[BAC] CH73-182H3 (1)

Genome Resources: Vega_Trans:OTTDART00000050096 (1),  Ensembl_Trans:ENSDART00000129704 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC134952 (1) 1575 nt
GenBank:EE694097 (1) 923 nt
GenBank:EG566462 (1) 894 nt
GenBank:CO351504 (1) 600 nt
CITATIONS (2)