Transcript

vsnl1b-202

ID
ZDB-TSCRIPT-131113-2245
Name
vsnl1b-202
Previous Names
  • vnsl1b-001
  • vsnl1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055197 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055197|OTTDARG00000038524|ZDB-GENE-080225-39 vsnl1b|OTTDARP00000043294 vnsl1b-001 LG_none CR925758.10,CR352340.10 Danio rerio protein_coding KNOWN, 1946 bp
CAGCAACCTTCTTGCTGTGAGGCGACAGTGCTAACCACTG
AGCCACCAATGCAATTCAAAATCGTAAATATACGAGTCTC
TTTTTGCTTTTATCTAGGTCAGGTGAGCATGCTGAGAGAG
TATAGAAGTAAATAAAACATGAATTACAGACTACTATTTA
GAGAACGCACGAGAGTTTCTTGAAGCCTCAAACACAAAGA
GCAGGGCGCGTTTTACATGACAGAGCATGCATGTCTACAT
CTAAAGCCTGCACACTGTGGTTAATAGAGTGTTTACTGAC
ACGAGCCCCCTAAGAGCAGGGTTGCAAGCGTACAATTTGC
GCAAACGCACGCTCGGAGCATCAGCAGCAGTAGTGGTGAT
GCTCTCTGCATGCCGCATGTCTTGCGTCGCATAGCGCACA
CACACGCGCGCGCACACAGAGAGACGGAAGCGGGATCGTG
TCGGCTGGAATCACCTTTACACATTATTCTGCGTTCGGTA
AAAAAGCAAACCGCGACGAATCCGCGGAATTTGGGCTCGA
CACACGCAAAAGCCGAGCACCAGCGCATTTCCATCAGCCT
CCAAACACGCAACTCGAAGTAATCATGGGAAAGCAGAACA
GCAAACTGACCCCTGAGGTGATGGAGGATCTTGTGAAGAA
CACAGAGTTTAACGAACATGAGCTGAAGCAGTGGTACAAG
GGTTTCCTGAAAGACTGTCCCAGCGGCCGACTAAACCTGG
AGGAGTTCCAGCAGCTCTATGTGAAGTTTTTCCCCTACGG
CGACGCATCCAAGTTCGCTCAGCACGCATTCAGGACCTTT
GACAAGAACAGCGACGGCACGATTGACTTCAGAGAGTTCA
TCTGCGCCCTGTCCATCACGTCACGGGGAAGCTTTGAACA
GAAGCTCAACTGGGCTTTTAACATGTATGACCTGGACGGA
GACGGCAAGATCACTCGAGTGGAGATGCTGGAGATCATAG
AGGCGATATATAAGATGGTGGGCACGGTGATCATGATGAA
GATGAACGAGGATGGTCTGACACCCGAGCAGAGAGTGGAC
CGGATCTTCAGCAAGATGGATAAAAACAACGACGACCAGA
TCACACTAGACGAGTTCAAAGAGGCGGCCAAGAGCGACCC
GTCCATCGTCCTGCTGTTGCAGTGCGACATGCAGAAGTGA
GGACGCGCATGCTAGCATGACCCGGACTGATCCACGCTCA
TTTTCCACCCAGAGTCACTGGACTACTTTTAAACGAACTT
TTATTCTTGTGATCTGACAACTAGTATGCATGAGAATGTT
AAACGCTAAAAGAGTTTAGAGTATATCCGTTTAATTTGCG
ACATGCATTAAAAACAACGCTAGACGACGTATAAATTAAA
ACCAGTCTGGTTGTTCTTTCACGCATCCATCGTCAGTGAA
GTGCTCTGCTGTATTTCATTTCTAGCCGCAATACTCGCGA
ACACACACACACACACTGCCGTATTCTGAGTTTTGGACAC
CCAAACACGTCACACTTAAATGTAACGATGAAAAATCAGT
CTGTTGAACTTCAATACTCTGAAATTAAAAGAAAGGAGGG
CCCTGAGGTTTATGCAGCCCTCCTTCCAAACGTGCTTGTA
CTTGAGAATATAAATGTAAAAGTTATTTGCATGCATGTCC
TAAGTGTACAAAAAAAAACTTCATTTCGGCAACCTTGACG
AATAATACAAGGGAGGCCTTATATAAATGATAGTATCGAT
AACAATACTAATGTGTGAGATTGACATTCGTTGCTCATCC
GTCCCATTAGATGTCCTCCCTCGGGTGCATGTTTCCTCTT
AAAAACTGTGTGTTGTAAATGCTTTCGGTTTCCGCCTTCG
TCTTTGTTGGATTCACTATTTCTTTTTTGCACAAACACGA
GGAGCAAGGTTATTATAGTTAACGAAAACAAATGAAAAAA
CGAAAACTTCAATTGAAAAACATTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations