ZFIN ID: ZDB-TSCRIPT-131113-2234
Transcript Name: xgb-201
Previous Name: xgb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055161 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055161|OTTDARG00000038497|ZDB-GENE-050125-1 xgb|OTTDARP00000043261 xgb-001 LG_ CU929419.6 Danio rerio protein_coding KNOWN, 461 bp
GCTTTTTTTATTTACCTCAGCGTCGCTGCACGGCGGCATT
TCTTCGGTGAAATTCAGGTTTCAGGTTGTGAGTGTCTCTG
AAGGTTTGATTCTGTCAGTCATGGAAAAGCAGAGCGACTA
GAGACGCGATCAAACTATTTAACTCGACCAGCTGATTGAA
AACTAACCAGGGCTGGTTTCAGGATGGGCTGCGCTATTTC
GGGCTCCGGACTGACAGCGAGAGCCCCGGAGATCAGAGCC
GGGGAGGAAGAGACTCCGGCGGGACTCACCGCCAATCACA
TCCGCCTCATCAAAGAGTCCTGGAGGCTCATTCAGGAGGA
CATCGCCAAAGTGGGCATCATCATGTTCGTCAGGTTGTTT
GAGACTCATCCAGAGTGTAAAGATGTTTTCTTCCTCTTTC
GGGACGTGGAGGATCTGGAGAGGCTGCGCACCAGCAGAGA
GCTTCGAGCCCACGGCCTGCG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
xgb-201 Contained in:
OTHER xgb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055161 (1)
  • Ensembl_Trans:ENSDART00000156489 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC133862 (1) 1120bp
    CITATIONS (2)