Transcript

itgb7-201

ID
ZDB-TSCRIPT-131113-2227
Name
itgb7-201
Previous Names
  • itgb7-001
  • ch211-233b16.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055134 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055134|OTTDARG00000038477|ZDB-GENE-100728-2 itgb7|OTTDARP00000043237 CH211-233B16.4-001 LG_ AL954698.9 Danio rerio protein_coding PUTATIVE, 2440 bp
AGATGAAGGCTGTGCTGATAGCTTTGATGGTTCTCTTACA
CTGTTTGGGACAGAAGTATACACTAGGGGAAGAACCCGTT
TGCCAAAATCAGCCTTCATGTTCTGAATGTATCAGGAGTC
CTGGATGTGCTTGGTGCACACAAATGAACTTCTTGAAATC
GGGTGAATCTAATGAACGACGCTGTGATTCTCCGAAGTCT
CTGAAGGATAGGGGTTGTGAAGATGTTCGTGTAATCAATC
CTGGAAAACATCCATTGGACTATGTGAAGAACAATGACCT
CAGCAATGATTCTTATAATGTGGTTCAACTCAAACCTCAG
AATGTCAACATTAAACTACGAGTTGGAGTTCCATATGAGT
TCACAGTTGAGTTTAAGAGGGCTCAGGGTTACCCTATAGA
TCTGTACTACCTGATGGATCTCAGTTACTCCATGCAAGAT
GATCTGGAGCAAATCAAAACCCTAGGGCAGAAAATCCTCA
AGAAGCTGAAGGACATCACAGAGACCGTCCGGATTGGTTT
CGGGTCTTTTGTTGATAAGGAGATGTTGCCGTATGTCAGT
CAGCTGCCACCGAGACGTAAGAACCCCTGTCCCAATCGCA
TAAACACTTGCCAGAAAGCGTTCATGTTCCAGAATGTCCT
GCCACTGACGAGTGATGGCAGAGAGTTTGAACGGGAGGTG
AGTAAACAGAACATCTCTGGCAACCTGGACTCTCCTGAGG
CTGGTCTGGATGCTATAATGCAGGCTGCCGTCTGTAAGGA
TAAGATCAAATGGGGTAATGTGACACGGATTTTGGTGTAC
ACATCTGATGACACCTTTCACATGGCAGGAGACGGACGAC
TAGGTGGCGCTTTTCTGCCACATAATGGACAGTGTCATTT
TAATGATATGGGTTCTTACATTGGAAAAGCCTATGATTAC
CCATCAGTGGGTCATGTGTCTAGAGTTCTGCAGGATAACA
ATATTCAGCTCATATTTGCTGTCACTGAGGAAATCTATCC
TGCATATAAGGCGTTGAGTGCATTGATTCCTCAGTCAGTG
GTTGGTGTATTGAAGAAAGACTCCAGTAATGTGGTTGATC
TCATCTCTGAGGCCTACGGGAACTTGTCGTCTACACTGGT
GTTGGAGCAGGAAGGAGCTCCAGCAGAACTGATGGTGTCC
TACAGGTCGAAATGTAAAGACAATCAGGCGGCCAATGAAT
GGAGGGAAAAAGGAGAATGTCAAGGCATCAAGCATGAGAA
GATAACGTTCCAAGTACGTTTGAATGCAACAGCATGTCTG
AAGGAGCCTCAGATATTCCGGATCAAAATGCAAGGCATCA
GTGAGGAGGTGAAGATTACAGTGGATACCGAGTGTCAGTG
TGACTGTGGAGCTGCAGAAAAGTCTTCTGAACACTGCAAC
CATAAAGGAGATCTGTCATGTGGCATGTGCAGCTGTGACG
AAGGGTACTTGGGTCAGAACTGCAGTTGCGTGCAACAGAA
CGATACCATCAAAATGCTGGATTCCTGCCGGCCCAACAAC
AGATCACTTGTTTGCAGTGGCCAAGGATCCTGTGAATGTG
GCAATTGTGTGTGTAGAAACGAGTACAGCGGAAAATACTG
TGAGTGTGATCCTGACAGCTGTGAAAAACGCAATGGAGTG
AGATGCAATGGTAAAGGCAAATGCGAGTGTGGTAAATGTG
AATGTAGAGACCGATATACGGGTTCCGCGTGCGAGTGCTC
ACCTAGCCAAGACAAGTGTAAGAATGATTGGGGCCTTTGC
AGTGGTCAAGGGGAATGTGTTTGCAACCGCTGTCATTGTA
AACCAGGCGTCATTGGAGATTACTGCTCTGCTTTCATGGA
CGCTTGCGAGCTGTTCAAGGACTGTTTGGCATGTCATTTG
GAAGGTAGCGGCTCCTGTCATGAGAGATGTTTCAATGCTA
CAGTAAAACATCTTGAAGGCACTCATGAATTGTCTTGCAT
ATATAAACACGTTTCATACAGTGTGGAGCTTAAGGCCAGT
GGCGAAGTTAATGTTAAATATGCAGACCTGCCTCATACTG
TTGATAAGACTGCAGTTATCATCGGCAGCTCTGTGTCTGG
AATCATTATAACTGGCATTATAATAATCATTATTTACCGT
CTCCTCCTGGAGCTGTACGACTATAGAGAATATCAGAGCT
TCGTCAAAATGCAGAATCAGACGCAGTGGAAAGAGGCCCA
GAATCCTCTTTTCAAAGGTGCCACGACAACAGTGATGAAC
CCTTTGCATATGCAAAACGAAGCATAAATTTAAAGACAGA
GCAGAGTTCTGGGAGTTTGCTATTGTAGTTTCATGTTTCT
TTTCACTTTTTTCTTTTAGACATTTCACACTGTGCAGCTT
GAAACTGTGTTCAAAATGTATAGTCTAGGCCAGTGGTTCT
CAAACTGTGGTACATGTTTCACAAGTGGTATGCAGGCTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations