Transcript

zgc:152986-201

ID
ZDB-TSCRIPT-131113-2215
Name
zgc:152986-201
Previous Names
  • dkey-28n18.11-001
  • zgc:152986-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055098 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055098|OTTDARG00000038455|ZDB-GENE-061013-762 zgc:152986|OTTDARP00000043214 DKEY-28N18.11-001 LG_ BX936393.13 Danio rerio protein_coding NOVEL, 806 bp
GATTCAATCAATCGGAGAAAGACTTTTGTTCATTAAAGAA
GTTTGGGTCGGCGTTGATTGAAATTTTGCGTTAATAAAAC
ACGCTAAGTCACTGTTTTATCTGGAGAGGTACTTGGTGTA
AAAATATACTCAGGTGCATGATGGCTACAGTATTATGCAT
GATACTTTTGTTATGTGTGTATGGCTGTCATTGTGTGAGT
GACTATTACTCTGTGCTTGGAGTTTCTCGCTTTGTGTCTT
CAAGAGACATCAAGAAAGCATTTCACAAACTGGCTCTAAA
ACACCATCCTGATAAGAACCAAACCCCAAATGCACAGCAG
ACCTTCACACACATTGCTCAGGCCTATGAGGTACTTTCTG
ACAGAGAGAAGAGACGAGTTTATGATCAAATGGACCATCT
CTCAAACCCTGATCAGGGCAGTGAGAGAATGGTCAAGAAA
GACCAGACAGAAGACATGGGCAGCAATCTTTTCTCTAATA
AAGGATCGTTTCAGAGTAAAAAGAGTTTCCAGCACTTCAG
TCTAGAGGAGCTGCTTCATACACTGCAGATGGATGATGAC
TTCTTCATGGGTGAACAACCTGGTCATGAAGGATGGAGTT
TTATTTTTGGACCTGAGGATGATGATAATGATGAAACGGT
CCTCTTCAGTGATCTTTTCAACATGTTTTGATGCTTGTGT
ATCCTCATGAACATGCAGTGTTTTTATTTATGTGTGTGCA
TTACAGCAGTTCTTATTTTAAGATGCTTCTGTATGATCTT
GTTATGTTTTTTATTAAATAAAACGTCAAGTTAAACAGCT
AAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations