ZFIN ID: ZDB-TSCRIPT-131113-2211
Transcript Name: b4galnt1b-201
Previous Names: b4galnt1b-001, dkey-195m11.9-001, si:dkey-195m11.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055085 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055085|OTTDARG00000038446|ZDB-GENE-100728-3 b4galnt1b|OTTDARP00000043202 DKEY-195M11.9-001 LG_ CR753817.13 Danio rerio protein_coding NOVEL, 3662 bp
GCGCGTGTGAAGCTGCATCATTCTCTCCTCCTCTCCGTCT
CTCCCTCATATGCGCGCATTTCTCCGCGCTGCAGCCCTCC
ATCGTTATTCACAGAGGGGGTTGCCCGACTCCTCTCCCAT
CTCCTCCATTCCGTCTCAGAGGTGGATGCCATGCCATCAG
ATTTTCTTCATTTATCAGCTGTTTGCGTTCACATGACAAG
CCCGCCGGGGGTGTTTTAAGGGTAGGAGATCCCTCTTGGT
GGCGACATTACAGCAGATGGAGAAAGCCCTCCATCAGCTT
CATCAGCTACTGTCAGTCACATCAGGATTGAGTCAGTCAG
TACCATGGACCTTTAGGAGCAGGAATGGCAACTTACAGCA
CCTCACGCTCTGACTGGACTGATTTGTAGCATGCGTTCCC
TACGTAAGACAGTGCTGTTAGCTCTGGTAGCATCAGTGGT
GCTGGTTTTGGCAGTGCTCCACTCGTGGCCCACACGGGTC
TACAGTACCGTGGATGTCCGGTATAGACCAGGTCCTGGAG
CTGAGCGGCTGTTGGAGGAGAGACTTCCCGAACTGGACCC
CAGCGCCAGCACCATCCCGTACCGCGTCAGGGAGAGTGTG
GCACGGCTTTTGGCTCGTAACGGCTGTGTTTGTGAAGGAG
AGAGCAGAGGGGTCAACCTGCCCTTCGCTCAGCTGTTGTT
CCCCAGAGTCTCAGCTCATCCCCTGCACACTGCCTTCCAG
GCTTCGCAGCTCGATGAGATGAAGAAACGCCGCGCCAAAG
AGTACCAGAGCTTCCAAATGAGGTCGCAGACCCCTGCTGA
TCTGCTGATTGTAGCTGAAGCTAACAACCCCCTGCAATAT
CCAACGCAGGGTGTGGAGGTTCGGCCACTTAAAACCATCC
TTATACCAGGTTTGGCCTTAAAAGAGCTGCCCCGAGATGT
CTATACTCTCAATTTTTCAGCATCTCTGGGCACGTTTAAT
GTGGCAGCAGAGGTGGAGGGGGTGAAGGTCAGGGGTGACG
GCGAGATGCACATGACTCTGAGCAGCAGTGTTTTGTCCAG
TCTCAATCGACAGCTCCAGTTCATCACATATACGAACACA
CTGTTCCACCCCAGCACAGCAGACACAGTGCAGTTAGACA
CAGAAGGACATCAGGCTCTTTTCACCATCAAGATCCGTCA
TGGAGTCACACCCAAACTCTACAACACAGGCTCTGATGCA
GATAAAGAGTATAACATCAGCGCTCTTGTAACCATTGCAA
CCAAAACCTTCCTGCGCTATGACAAGCTTCAGAATTTAAT
TGACAGCATACGACAGTACTATCCAACGGTTACAATAGTA
ATAGCGGATGACAGTGAACACCCAAAAACTGTGTCAGGCC
CATATATTGAACACTATATCATGCCCTTTGGAAAGGGCTG
GTTTGCTGGGCGTAATCTGGCCGTGTCACAGGTCACCACC
AAATATGTGCTGTGGGTGGATGATGACTTTATCTTCAGTG
CAAACACAAAGCTGGAGAAGCTGGTGGACGTTCTGGAGAA
AACTACTCTTGACCTGGTTGGAGGAGCAGTGCGTGAAGCT
ACAGGCTACACCGCCACCTACAGGCAGACTATCTCCATTG
AAGCCGGTGAGGAGGACGGGGACTGTCTGCACATGCGCAG
AGGCTTCCATCACATCATTCAGGGCTTTCCTCACTGCGTG
ATCACTGACGGGGTCATCAACTTCTTTCTCGCCAGGACAG
ATAAAGTGCAGCAAGTTGGCTTTGACCCTCGGCTAGCCCG
TGTTGCACATCTGGAGTTTTTCATCGATGGGCTCGGCTCT
CTGCATGTTGGTTCGTGTGATGATGTCATTGTGAACCACG
CCACTAAGATCAAGCTGCCCTGGGGCCAATCGGAAAGCGA
CAAAACGTACGCAAAGTTCCGTTACCCTCCAGCTTCATCC
GATGCGACGCACACCAAAAATGGCCTCTTGTACTTCAAAA
ACCGCTTTCAGTGTCTAACACACAACTGAACACACCCTGA
CTATGCCTTCTTTCCTTTCACACGTCCTCCCTCAAACGAA
CACTCTCTCCCCGAGTCGCTAAAAGGGGCCCGTGAAGACA
CTGGAGGTGCATCTACTGTATACGGCCCCATTGGGGGAGC
TCAAATAGGCCTCTTCTTACGGAAAGAGTCCTAATGTGAT
CGGACATGACAGACGGATGAGACGCACAGTGATGGCTGAT
TAGTTTTTTTGATACCTGAAGATGTCGTATTTTTGTCTCT
CCTTTCTTTAGCTTTATTTTGTTCAAAAGAATTCTTTAGA
TACAGATCAAACCATTCCGTAAATGATATCTTTTTCTCCT
CTCCTCAGCCAACCGTGTTTATTCATCACATTTAAAGGTC
CGGTTGAGCACAAAAACGTAAATTCTGTCATTATTTACTC
AACCAAACGGGGTGGTGAACTGACAAGTCAAAACTCATTT
GATCTTTTGACATTTAAGAGGTCACTGAGGTATAAAAATA
TTCTCTAAGTTTCAGAACTCAGTGTGCCCATTAGTCTAAA
ACAGCTTGCGTTGAATCCAGGTTACCAAAATAATCAGTTG
TGAATGAGTCACTCTATGATGTAATAGTGTGGTTAAACTC
CGCCTCCACTATTGAAGACCACTGCTTGCTTCACTGTCTG
TTTAGCCCCACCCACTGATTTAGGCTGTTGTCGGACAAAC
AAATGGCATAAATTGTGGGAAAAACATGTGGAAAAACATC
CCAACATCAGGAAATATTGGATAAACTGTATTTATATTGT
AGTTGTAGACTGCTTTAGGTCCTTTTTAACTTCATTTCAA
CTTCATCAAACTTTTTTTTATTGTGGATTGTTTTACAAAC
AAAACACAATTCAATGGTGGCTTTTCAGAAAGATTGAAAC
AAAAATGCTGTCACTAAATTGCATTCAAAATTAATGTCGC
ACCACACATTGCATTGGTTGGCACTAGGGCTGCACGATAG
TGGAAATCTGACATTGCAATATTTCGTTTTTCTTCGATAT
TTATTGCAATATGATTTTATTTATTTCACCAGATGACTTG
AATAGCTCAGTTTGAAAAGAACTCATCATCTTATTTGGAT
TGGGATGATTTCATAGGCCAGATTTGTTTGTGTAAGTTGA
ATAATTAAATGTAAGCAAATAAAAGTACACAGTCTTCATT
GTATAAAAGTTAAATTGTTATAATTTCTTGTACGCAAACT
ATTTAAATGCACTTGAAATCATGCATAGTCCTTAAAACAA
AGCAAACAGGCACTATTTCACTCTAGTAGGTTGAAACTTC
ACAAACACTCAACAATCTGGTTCTTGGTCAGCTATATTTC
CACTCAAATTTCCTGAGGAATGAATAAACTGAAGCTAAAC
TTTGCAGATCCTGCAATGTGACTATTGTCGAATGATCACA
TGATCACATTGTGATATGGATGCTGAAACTATATATTGTG
CAGCCCTAGTTGGCACACATCTATCCTTTTCATCTTTGGC
ACCTAATCTTTATTTAATTTTTAAACATGCAAACTTTTAG
TCATTCAGATTACAATCTGCCACGCATTTTCAAGCAGTGT
GTACATATGCGGAGGTCGAAACAGGACAGAAATTAGCCTA
TTACTACACTGTAAAAGAAATCAGTAATTTTATGGCTTAT
TTCTGACAGCTGTTGTGCCGAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
b4galnt1b-201 Contained in:
OTHER b4galnt1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055085 (1)
  • Ensembl_Trans:ENSDART00000154991 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB771904 (1) 409bp
    CITATIONS (2)