ZFIN ID: ZDB-TSCRIPT-131113-2201
Transcript Name: slc2a11a-201
Previous Names: ch211-13j1.2-001, slc2a11a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055054 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055054|OTTDARG00000038427|ZDB-GENE-080723-20 slc2a11a|OTTDARP00000043176 CH211-13J1.2-001 LG_ CR293534.5 Danio rerio protein_coding NOVEL, 4120 bp
TGGACATTTAAATGAACACAAGCAAGTGCGTTTTATTCAT
CGGGAGCTCTCAAGAAAATCTGAAAATCAATTATAAAATT
GTTTTACTTCATTTAGTCAAGAGGTTTGTTGGTTAAACTA
TACTGAAATTGCTTACTGGCTGTAACATTTGGAGACGCGT
GTCTCACTTATTTTTACGCACCGTCCGCAGAACAGCGATG
TCTCATGTAATGGCGAGAACAGAATAAACCCAAAGCTTCT
TTCTCTATTTTCTTTGGATTTCAATCTCTGGAATTATCAG
CACATTCGAAAGGACAACATGACAACAAAGGAGAAGAAGG
GTCATTCATACACTTTGGTTTTAATGGTGACATCTGCAGC
GATTGGGGGAACATTACAATATGGATACAACCTGGCCATA
ATGAATGCACCGACTATTTTTATTCAAAACTTTGTGAATG
AGACATTTCAGGAGCGATGGGGAATACAATTGGGGGTTTA
TGAAGTCACACTCATATGGACCTTTATAGTCTCCATTTTT
TCATTGGGGGGCCTTACTGGGGCCCTAATAGCAGGTCCAA
TGTCTGTACGTTTAGGGAGGAAGAAGACTTTGCTGCTTAA
CAATGTCTTTCTGTTATCAAGTTCACTGCTTGCACTGCTG
AGCCGAACAGCAAAGTCATTTGAGATGATTATTATATCAA
GATTTTTAGTTGGAATTAATGCAGGGATCAGTATGAATGT
ACAGCCTATGTATTTTGGTGAAAGTGCACCAAAGCACTTA
CGAGGAGCCGTGTCTCTATCCTCTGCTGTATTCACTTCAT
TTGGACTGGTTTTAGGACAGGTGGTCAGTTTGAGAGAGTT
GTTGGGTAGTGAGCCATATTGGCAGTACTTATTGGCAAGT
AATGCCATCCCAGGCTTCATCCAGCTCCTCACCTTGCCCT
GGTTCCCAGAGAGTCCCCGTTACCTCCTTTTTGACTGTAA
AGACAAGGAGGCCTGTCTTTCAGCACTGAAGCGTCTGCGA
GGCTGTGAGGTGCGGAGAGAAGAGCTGGATGAGCTTCTGC
AGGAACAGAATGAAATCAAAAGCGATCGTGCCAAGCAGCC
GTGGGATCTGTTGACTGACCGCAGCGTCCGCTGGCAGCTG
ATCTCGGTGGCCGTCTTGAGCAGTGCCATGCAGCTGTGCG
GTAATGATTCGATCTACTTCTATGCATCATATGTCTTCCA
AGAAGCGGGTATATCTGCAGGACAGATCCAATATGTGACC
ATCGGCACCGGGATGTGTGAATTTACTGCTTGCATCCTGT
GTAACCTGTTAATAGAAAGGCTGGGTAGGAAGCTGATGTT
GATGGGCGGTTATGTTCTGATGACAGGATGGGCTGTAGTC
TTCACTGTGGCTCTTTCACTTGAGAATATTGTTACCTGGA
TGCCTTACCTGAGCATGACCTGCATCTTCACTTACATTCT
CAGCTTTGGCATGGGTCCAGCTGGGGTGTCTGTAATCCTT
CCGACTGAGATTTTTAACCAGACAGCACGACCTGCGGCCT
GCATGACGGCTGGATTTCTAATGTGGCTAAACCTCTTCAT
CATCGGCATGATCTTCCCTTTCCTTGTGAGTGGTTTAGGA
CAGTACTGCTTTGTGCCGTTTGGCACTGTATGCCTCGTGA
CTGCTACATATATTCACATGGTTCTACCCGAAACCAAGGG
AAAGACCCTACCCATGATCACTAAAGAGTTTTACAAGCTC
AACTACCGTGGACACAGGAAAATGGATTTAGAAGCTTCAA
AAGCTCAATATAAACTTGGGGAAATCCTTCACTCCACTGC
CTTATAGACTGCTAAATATTCTCAACAATAAATATATATT
TTAGTACAATCATTTTAAACCTTTAACTTCCACTTAAAAA
AACTTTGACCAATTTTTAGGTTAAACTATGATAATCCTGA
TAGCACCCTAAGCAAATTTAGGGTTTTGTGTTTTAATCAC
AACCCATGGACAAAAGGTCAACCTGACGGTTATGATGCCA
CTGGGTTAAACATTTGCCTTATAGTTTGTTGTTTTTGTTC
AATGCGCCACCTGATGGATGTTCTGTGAACACATTTATTT
GAATTCCAAGGAGACTTTTACGGCATACCATGGCTATGCC
GTGACAGAAAATGCGGTGAGCCGCGGTAAAAAAAGCATTT
TTATGGAAACATCTATATGCCGAGTTTATACTGCACAATT
TTCAAAGTAGTCATGTCGCAGATGTTTTCACACAGCATGA
CTATCTGGGGTAGCATTCCGCCACTGCTGCGTTTACACTA
CAAGATGGATCGGCGACAGGGGATTTCACACTGCATGACT
TTAGGAGAATTGCCAACAACGCTGTCTTAGTCCACAAACT
ACGCCTCACAACCAAACACAAGCGAGAAGTCATATGTAAA
AAAAAATGGGAGGTCATGTAGTATTTCTTTTGTTATTAAC
CACTTTATAAGAAGCCTTCAGTGGGGTAGAAAATGTACTT
AATTTGGTAACCTTGCTTTTAAAGAGAATTAGCAATTTCT
CTCAAAAAGACACAGGTGCTGCTGCCAAATTTCCACTCGT
TTTTCCTTGATTTCTTGGGTCCAGATAAACTGAAAATAAG
CTGTCTTCTCTTTTAACTTCACCCCCAACCTCCCACTGGC
CTGTAGATACCCATACTAGAGGATGCTGCTCTCTCATTGG
CTGTAGCTAATCGCTGATGCTATTTCCAATTAAAAACACA
TTTCACACAGCATGATTTTATATCGCAGACAGTTCCAGAT
ATTAAGCACACAAAATATCTGACGGGGGGCAGCGACTTAT
CGGTGATTCTCTCAGATCGCATCTTTGTTAGTTTACGTTG
TGTGAACAAACACTGATTTGCGTGTGATTCCATGCGTTTG
TCGGCAATTTCTCAAAGTCTGTCGGTGAGTCAAAATCATG
CAGTCTGAACTCGGCATTAATTGGTCTTCATCCCACTGTT
TACATCTTTACTGTGTCTGCAAAGACTGTACAATAGGGCC
TATAAGATCCACAATAGACTTTCTGGATGGACACATCATT
GTTTTGCTCTGTCACTCTCTAATGCTCCACCATTTCAAAA
TAACATTATGAACACAGCGATTAAACTGTACTATCAAATT
TTAAATAGGGCTACCTTAGCAGAGCTTTGTGCTTTGGTAC
AAAATTATACAAGGACCGATCATTCCACTACACTCTCAGA
AATAGAGGTATGTGATCTTTTTAAAAGGTACAAATTTGTA
CCTAAAGGGCCCTACTAATACCTCAAAAGTACATGTTAGT
ACCTAAAAAGAACAAAAGTGTTCCTCTTAGAATTTGTAGG
TACTATAAGCCTTTGAGGTACCAGTATGGACCCTTTAGGT
ACAAATGTGTACCTTTTGAAAAGGTACCACCCCAGTGACA
GCTCACGCACCTTTATTTCTGAGAGTGCAGATGTCTAACA
AATAGATGTTTGCCATTGCCGGCTTTTAAAAACTGTTATG
GACAGAGATCTTTCTTTTTTGTATTCACGAAAGCCTGGAA
TGAGATCTAACAACATCTATAAACAATACCAACGCAGAAG
CTGTTTAAAAAAAAATCCCATACTCGTCATCTGATGATCA
ACTATCCCTGTAGCCACTGAGATAGTAGCCTGTTTCTCTT
TATTTAGTGTGTTTGGTGATTGTTTATACTGTTCTCATGT
GTTGATGGATGAGATGGTAAGGGTGTCTGTATGTTTTTAT
GTTCTGAGTCAGGCCCGATTACTATTTAATCTTTTCCTGT
TTAAAAAATATAAATAAATAGTATGTGAACAAAATGAGCC
AAGTATGAATTCACAGAATTTCAAAAACTATACCAAAATG
ACATACTTCTTCTGCTGATATTCTGAAGGGTGCATTTGAT
GGGGGCCATGGGGCCAATTGGTAGTGAACCAACACAACGG
ACACTGGCAGGTCACATGATATTGACAACAATCCAAATTA
CATCCAAAATTCATTAACGGATAATACCGATGTTTAAGCT
ATTGTATATTGAAAAAATTCTAATTGTAGTGATTTCCACT
GTATGTGAATTTGGACAAACCTTGTCCTCCTGTTGTGCTC
TTTTTGACTTGTAGATTAAATATTATTTTCTGCATAGGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc2a11a-201 Contained in:
OTHER slc2a11a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055054 (1)
  • Ensembl_Trans:ENSDART00000076069 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA474029 (1) 930bp
    GenBank:CA787315 (1) 916bp
    GenBank:CD759905 (1) 851bp
    GenBank:CK239846 (1) 788bp
    GenBank:DT072447 (1) 770bp
    GenBank:EH996644 (1) 753bp
    GenBank:CD283899 (1) 621bp
    CITATIONS (2)