ZFIN ID: ZDB-TSCRIPT-131113-2148
Transcript Name: kcnq2b-202
Previous Names: kcnq2b-001, ch211-158n11.6-001, si:ch211-158n11.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054869 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054869|OTTDARG00000038291|ZDB-GENE-120130-1 kcnq2b|OTTDARP00000043043 CH211-158N11.6-001 LG_ CU929258.13 Danio rerio protein_coding PUTATIVE, 4819 bp
AGAGTGGATCAGATTGTCGGTCGAGGGGCTCCAATTACAG
ACAAGGACCGTCCTAAAGGAACCACGGATGGAGAACTGCC
AGAGGATCCCAGCATGATGGGACGACTCGGGAAAGTGGAG
AAACAGGTCATGTCAATGGAAAGGAAGCTGGATTTCCTGG
TGAACATCTACATCCAGCGTATGGGCATCCCGCAGTCTGA
GACGGACGCGTACTTCGCCTCTAAGGAGCCCGACCCGGCG
CCTCCATACCACAGTCCGGTGGAGCACATGGTGAAGAGCG
GCTCCATCAACAAAATCATCCGCTCCAACAGCTCCGCCGG
CCAGAAGAACTTCGACCCTCCGCCTTCCACCTGCGTCAAC
CACCACTGCCCGCCCTCCACCTCCTGGCACCCCCAAACAG
CGCCCGAGGCCGGCCAGGGTTCATCTCCAATGGGTGACCC
CTCACTAGTGCGCATCCCTCCACCACCAGCCAACGAGCGC
TCGTCTGGAGGCCACAGCGGAGGCTCCCGCGGACATCATC
ATTCCCGTGGGACACCGGCTGAAGACGGACGTCCAGCTTC
CCAAGCGCAAGCCGGAGCTGAAAGCGACACGTCTATCTCC
ATCCCCTCGGTAGACCACGAGGAGCTGGAGCGCTCCTTCA
GCGGATTCAGCATCTCACAGTCTAAAGAAAACCTGGACTT
TCTGAACAACGCCTACTTTAGTGGTGTGTCGCGGTGCACT
AAAGTCCGGCCGTACATTGCAGAGGGTGAATCGGACACGG
ATTCTGACTTGTGCGCTCCTTCGCCTCATTCGGCCACCGG
TGATGGTGCATATGCAGACAGAGGCTGGACTGGCAACAAG
TAAAACGAGGAGAGATGAATGAGAAATGGGATTCAACCAG
CTGCTGGAATCAAGCTTCAAAATACGGAAGCTGCTGTGTT
TAGGAAAGCGCAGCTCCATGAGCAGAGTGGGAGAAGGCGA
GTATGAAGAAGATGACAGAGTATGAAGAAGTATGTGATCT
CAGAAGCGCCAGAAATGACTTCTGGGAGTCGAGGAGTTGA
TTATTCGTCAGTTTGGTGGACGCCTGATGGCTGTGAAGGA
TTGATGCTAATGTGAGGACAGACGAGAGACAATGGAAAGC
TTTGTATGTGGTGCATTTCGTCTTTAAGTACACGTTCACT
CTTATGGATTTACACATTGTTAATGTTTGCGTCTGGCTTA
AAGGGATCGCTCACACAAAATAACACTTAAACTATACTTA
CTTTTATGTCATTCCAAACCACTTATGTCCTTGTGCACAA
AATATTAAAATAACTAGACAGATTATAGCATCTATCAAGC
TCTAAAGAGGACCAAAAACTACACAAACAAAATCATAAAG
GTGCATTTACAGTTATTTACAGTTATTTACTCTCTTTGAT
TATTACATTCCGTGGGAGTCGAACTCTTGTGTTACTAGTG
CAATATACTACAGTCTGAGCTGGTGTATGAAAAGCTAAAT
GAACTGACTCATACAAAACTACACAAAAGCACCAAAACTA
TCCTAAAGGTGCATTTATAGTTATGCATTTGTCATATCCC
TTTATGTCTCTTAGATAAATTTCATTCAATTTCCTGGGAA
TCGAACCTATGATCTCGTGTCATGTGCTAAGTGCAATGTC
CTATTATTTGAGCAAGCTTATAAAAAGCTACGATAGTTTA
ACTGACTCATTTAAAACTAAACAAAAGCATCATAACAATG
TCCTAAAGGTGCATTTATGTTCATGAATTTGGCAGATGAT
GATGTCTAAATTTGTGCATTTCCTGAGAATCGAACCCATG
ACCTTGCGTGAATACAGTGCTTTGCTATTTGAACTGGTTT
TAAAAAAAGCTAAATTAACTGACTCATACAAAACTACATA
AAATCACCCTAAAAAAAATATAATAAATGGGCAGTTCTGC
ATTTGTCACATGTTTTTATCTTGGATAAATTTCATTTTGA
TTCCTGGGAATCGAACTCATGACCTTGTGCTAAAAGTGCA
ATGTCCTTTTATTTGTGCTTTTTTATAAAAGGTACAGTAG
TTTGCCTGACTCATGCAAAACTATACACAGCACCCTTAAA
ATATCCTAAAGGTGCATCTATGTCCATGAATTTGGCAGAT
GACGATGTCTTTTACTTTATATATTTTTAAAAAGCTAATT
TGACTAATTTAAAACCTTAGAAATATCATAACTATACATT
TTTTCATTTGTCAGATTTATTAATTTGTGCATTGACTGGG
AGTTGAACCCATGACCTTGTGTTACACTATTAGTGCAATG
TTCCAATGTTTTAATTAGTTCCTAAAAAACTACTGCAGTT
TTACAGACTCATGCAAGACTATACAGAGCACTATACAGAT
GTCATAAAGATACATTTACAGTTCTGCATTTGTCAGATGT
TTTTATCTTTGATAAAATACATTGCTATCCCTGGGAATCG
AACCCATGACCTTGTGCTACAACTAAAATGTCCTATTATT
TGAGTCAGTTTATAAAAAGCTACAGTAGTTTAACTGACTC
ATCCAAAAATATACAAAGCACCATAAAATATCCTAAAGAT
GCATTTACATTCATGCATTTGGCAAATGATGGTGTGTAAG
TTTTGTGCATTTCCTGGGAATCGAACCCATGACCTTGTGT
GGTAAATAGTGCTCTATTATTTGAGCAGTTAGTTTTAAAA
AAGCTAATTTGACTGATTCATTCCATAAAAAAAGAGAAAT
GCATATTTATGCATTTGTCAGATGCTTTTAATAATTTGTG
CATTGACTGGGAATCGAACACATGAACTTGTGATGCACTA
TCAGTGCAATGTCCTACTGTTTTAACTAGTTCATAAAAAA
GCACCGGTAGTTTTACTTACTCATGAAAAAGTATACAAAG
CACCCAAAAATATCATAAAGTAGTATTTATAGTTCTGCAT
TTGTCAAATGTTTTAGATAAATATCATTGCTATCCCTGGG
AATCGAACCTATGACCTTGTGCTACAACTGCAATGCCCTA
TTTTTTGAGCTATTTATAAAAAGCTACAGTAGTTTCACTG
ACTCATGCAAAACTATACACAGCACCATAAGAATATCCTA
ACTGTGCATTTACATTCATGCATTTGGCAGATGATGATGG
TGTGTAAGTTTTGTGCATTTGAATCCAACCCATGACCTTG
TGTGGTAAATAGTGCTCTATTATTTGAGCAGTAAGTTTTA
AAAAAAGCTCATTTGACTGATTCATACCTTAGAAATATAA
TAAATGTATATTTATGCATTTGTTAGATGCATTTATTAAT
TTGTGCATTGACTGGGAATTGAACCCAAGACCTTGTGTTA
CACTATCAGTGCAATGTCCTACAGTTTTAAGTTCATAAAA
AGCTACAGTAGTTTAACTGACTCATGCAAAACTATACACA
GCACCATAAAAATATCCTAAAGGTGCATTTACATTCATGC
ATTTGGCAGATGATTTGTGCATTTCCTGGGAATCAAACCC
ATAACCTTGTGCTACTTTGTAAAAGTGCAATTTTTTACAG
TTTGAGCTAGTTTAATAAAAGGGAGTGTAACCGACTCATG
CAAACTTACATAAAGCACCATAAAAATAATGTGAAAGTGC
TAAGAAAAAGTCATATTCAACATATTCGACATCAAGGTTT
TAAAATGTAATATTTATTTGCTTATAAATGGCATGAAGGC
CAAATAATAGGAGATTACGGTGTGAACGATCCCTTTTAAA
AGTGTCTTTGTTGTTTCATGTGGTCCATGTTTTGCTTGTG
AATGTACTTCACGACAGCTTGTGAATTTGAATTTAAAGCA
GGTCACTTAATGTCCATCACAGTATTCCCTTAATTGACAC
CATGGTTAACAAATTCACCTCAAGTACGTACGAAATATAA
AACATCACCTCCTCTCAAGTTTACAATTTTTAATACTCCC
TAAATCAATAATTTGCATGTCAGTAAATTAGGAATATTTA
GAAAGAATGTGTATTCAGAAAGTTAATTTCATACAGCTTC
TTCAAAAAGTGGTAACGAAAAGCCTATTTTTTGCCAATAT
TTGTTTCTTTTCTTAAAGACACTAAACCGTCCAAAGCAAT
TTCTTAAATACAATGTACATAAACTATTTCTGTAACAACA
AATGTATTTAATAATGTAAGACTTCCACTTCACCGCCATT
CAACATCAATATGATTATCCCATGTTATGATATAGCCATA
AGGGCCAGACGGAGTATGAAGTTGTACTTAGTTCCCCTTG
TTAGTTAGTTAGTTAGTTAGTTAGTTAGTTAGTTAGATAG
TTAGTTAGTTAGTTAGTTAGTTAGTTAGTTAGTTAGTTAG
TTAGTTAGTTAGTTAGTTAGATAGTTAGTTGAATGTGTTA
ACTCACTGGTGAAACAGGGAAATCTACTCTTCTGAATGCA
CTAATTGACTGAGAGCACATGGGAAATGCATCATGTCGTT
TCGCCTTGTTCTGATGTCATTAACGCTCTGTTGCCTTTTA
TTGTTAATTTCATTGCTTGAAACCGTAACGAACAAAAGCG
CTTGTATCGCGAGTTGAGTGGATATTTTGTGTAGGAGTGA
GCACTTCACACAGGAAGACTGCCCGTCTCCAAAGAGGATT
ACAGTTAGTTTATATCATCCGTCTTCCACATTGCTTGTGT
TCACAGTCTTTCCTCAAACACTCCCTTTAATGCTGATTAT
TTAATCTGCTGCTTGTGCTGGATACATTGAGGAGACCGGG
GTTAGTGCTTACACTTTTTACACCACTTAATTGAATCAGT
TTTTTTTTAAACTATAAATATACAGGTCCCACTTTATATT
AAGTGTCCTTAACTACTAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kcnq2b-202 Contained in:
[BAC] CH211-158N11 (1)

Genome Resources: Vega_Trans:OTTDART00000054869 (1),  Ensembl_Trans:ENSDART00000156375 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)