Transcript

ptger3-201

ID
ZDB-TSCRIPT-131113-2136
Name
ptger3-201
Previous Names
  • ptger3-001
  • dkey-66a8.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054809 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054809|OTTDARG00000038244|ZDB-GENE-120508-5 ptger3|OTTDARP00000042998 DKEY-66A8.5-001 LG_ BX324166.8 Danio rerio protein_coding NOVEL, 1206 bp
ATGGCATCAAAATGTAAGTCTTCAACTGTCTTGCTACAAA
ACCTGACTGCTGGAATCATGCCGGACTCGAACATTTCCAA
ATCTTCACAGGACAGCCCGGGCAGGAGCGCCGGCTGCGGG
TCGGTGTCCGTGTTTTTCCCCATCACTATGATGGTCACTG
GAATGGTGGGAAACTCTCTGGCGATGCTGCTTGTTTATAG
TGCATACAGAAAAAAAGAGAACAAAAGGAAGAGATCATTT
CTGCTTTGCATCGGTTCATTGGCGTTAACTGACCTTTTCG
GACAGCTGCTTACAAGTCCGATAGTCATCTCGGTGTACAG
GGCAGATATGAAATGGGACCGCGTGGACCCGTCCAAAACT
CTCTGCGCCTTCTTTGGGGTTTGCATGACCACTTTTGGCT
TGTGTCCTCTCTTTTTAGCCAGCGCAATGGCTATTGAGAG
GGCCTTGGCCATTATTGCGCCTCACTGGTACTCGCATTAC
ATGAAAACCAGTGTGACCAAGCAGGTCCTGGTCATCATTT
GGTGTCTGGTTTTGCTCTTTGCCTTGTTGCCCATTGCTGG
TGTTGGGGAGTACACGTTGCAGTGGCCAGGCACTTGGTGC
TTCATAAATACTGGTGACAAGGACGTAACGGGAAATACGT
TTTTTGCCACAACCTTTGCAGCACTGGGGATATTTTCACT
GCTGGTCACCTTGTCATGTAATGTGGTGACCATTCGTGCA
CTGGTTACAAGGTGCAAAACCAAGTCAAGCTCGACCCAGT
CATCAAAGCAGTGGGAGAGGTTGACAACAGAGACTGTTAT
TCAGTTGATGGGCATTATGTGTGTGCTGTTGACATGCTGG
TCACCTCTACTGGTCCTTATGTTAAAGATGATCTTGACTC
ACACATCCTCTCACCATTGCTATTCTGCTGGATCTCTGTC
ACCCCAGGAATTGCAGAAGGACTGTAATTTCTTTCTGACA
GCCATACGGCTGGCCTCACTCAATCAGATTCTGGATCCAT
GGGTTTACCTGCTCCTAAGAGAGATTCTCCTGAGGAAGTT
CTGCCAGGTGGCCAGCGCAGTTTCCAAGTGCTCACTGGAC
GTGCAGAAACAAACTCAGTGTCCTCTGGATGTCCAAAATA
AAAAGGCCATTCAGAACGATGATGTTCACAAACAATCCCT
GAACGTGGAAAACAGTATCTTGAACGTGGGATGTGAAGAA
CAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations