ZFIN ID: ZDB-TSCRIPT-131113-2118
Transcript Name: lurap1-202
Previous Names: lurap1-001, dkey-218b7.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054676 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054676|OTTDARG00000038159|ZDB-GENE-070928-35 lurap1|OTTDARP00000042923 DKEY-218B7.5-001 LG_none FP236326.7,BX088595.7 Danio rerio protein_coding NOVEL, 1607 bp
AGCCGTATGATTTAAGCTTCACGTCAGTACAGCCGTTCAG
CTTGAGCTCCGATCCAACCCTGACTTTATATCCGTGCACA
ACATCCACACTTCACCTCAGCACAGCGATGGCATCATCCG
CACAGAGAGTATAGAGCACGTAGATCTGAAGCGTTTTAAC
GACGATCTTCCGAGAGACGCGCATCATGCTCAGGTGGTCC
GTGTTTCCCACCGAAGAAGGAGATCATTCAGACTGCGTTC
GGGAGAGAAAACAGTCGTGTGAATGTTCAGAATATTAATC
AGACCCGTTTTCTAATCATGGAGGAGAGTAATAATACCTG
TGAGTCAGTTCCTGATTTGAAAGATCTGGAGTTGAAAGTG
GGTAGAAAGACCCCAGAAGGGCTCCTGAAGTGGATGAGAG
AAGAGCACAAGATGATCTCTCATCATCAGACTGACAATAA
TGAGACTGAGAAGAAAGGTCTCGATGGGAAGATACGAAAA
CTTAAAATGGAGATGGCTCATCTACGAGCAGCAGATGTCA
AAATCTTGAACCAGTTGCTAGCACTGCATGAGGGTATCGA
GGCAGTGAAATGGCTTCTAGAAGAACGTGGCGCTCTCACC
AGCCGCTGCAGCAGCCTGACCAGCAGCCAGTACAGCTTAG
GGGAGGGTCCTGACACGTCCTGGAGAGGCAGCTGGAGCAG
TCTGCAAGATCCCCATGACAAGCTGGACAACATTTCCATC
GGCAGCTATCTGGACACATTAGCTGATGAACTGGATGAGT
ACTGCCCTTCCAGTGGGACTGAGTCAATACTCTGTGCCAC
TCCTATGGGGACTGGAGGAGGGGTCAGCAGTTCCACTGGA
TCTGGAAGCAGACCTCCTCAAGTCAAAACAGATGCCACTA
AAGAAGAAGCTCAGGTTTGGAATAAAGCACCGTCTGAGAC
AGCGAGAGTTAACAAGACCAATGGAACCCTGGACAAAACA
GCGACTCAATTGGTCAGCTCAGATTCGCCCAGAGCTTGTC
TCGCTGAGAAGCTTGGGAAGAATCTGAGCCCTAAAGTCAA
ACCATACAAAAATGGCAAGGTTGAGCTGGAGAGCTGTAAA
AAGAATGGCAAAGTTCAACTGGAGTACGATGCACACTGGC
GTTGGGTTCAGTCGCAGGATGATGTAACGTTTTTGTGATA
GCATACACGATTGCTCAGCCAAAGCTGGGAGATTGGGGTT
TAAACACTGAGGTTTTGTTTGCCGACTTTCATCTTTGATT
AATGTGAGGCCAGATTCTCAGGTCTCCTTTAAATAACAGA
GGTTAAACGTTAACAACAGGAAAGAATAAGAAATGGAAAG
AAGCTTAAACGTGTGAATTCAGAGTTTAAAAAGCCTGAAT
TAGTGGTTGTTAGATGTGTATGGACGCATGTTTTCTGTGT
GCATTTCAGTTTTTTTTTTTTTGGCATTGATTGATTCAGC
AAAGCTATTTATTAATTAGTCATTAATCCTTTATTGCATA
TTCAGTGCAAACATTTTATTTGAATTACAATGATGTAATT
GCAAATTGGTGTGCTTGCAAATCAACTTTTTGTAGTATAT
TTACATTGGCATACAGAACTGCGGTACAGACCAATTAAAA
AAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lurap1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000054676 (1),  Ensembl_Trans:ENSDART00000065215 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC151995 (1) 1614 nt
GenBank:CO957514 (1) 803 nt
GenBank:EB931335 (1) 716 nt
CITATIONS (2)