Transcript

kif1aa-202

ID
ZDB-TSCRIPT-131113-2109
Name
kif1aa-202
Previous Names
  • kif1a-001
  • kif1aa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054631 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054631|OTTDARG00000038127|ZDB-GENE-100913-3 kif1aa|OTTDARP00000042894 kif1a-001 LG_none CU467071.9,AL929287.5 Danio rerio protein_coding NOVEL, 9247 bp
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTACTGCA
TTGATGCTTCTGCCCTCCTCAGTGATGATGTCACTGGTTC
AGCCAGTCTCAGCATCACAGCTCTAGGCAGAGCCAGCAGA
GCCATTTTGGCTTCTACATTACAGAACACTCAAAGATCTC
TCCTCCAAGAAGCAGGCCTTAGCGGGCATCCGGCTACACG
ACATCCCTCTGTGGAGCAAATAAAGGATCTTCTGTTTAAC
CAAGGGAAACCCAGACTGTTTTCTCCATATCAGAGGAAGA
GCAGAAAAAGGAAAATTTGAGAAGGCAGCGGTGGGAGCTG
ATTCTGTAGAGTCAATAGCTGAGAGCTGCATCAGAGGATC
ACCATTGTAGAGGTGAGCAGTGACCTGAACGTTTAAAGGA
GGGCTCTGAACACACAGACGGAGGCACCATGGCAGGGGCC
TCGGTGAAGGTGGCGGTGAGAGTTCGTCCCTTTAACTCTC
GGGAGATCGGTAAAGAGTCTAAATGCATCATCCAGATGTC
CGGAAACACAACCACCATCATCAACCCCAAAGCACCCAAA
GAAAACAAAAGCTTCAATTTTGATTACTCCTACTGGTCAC
ACACTTCGCCTGAAGATATCAACTATGCGTCCCAGCAGCA
AGTCTACAGAGACATCGGAGAGGAGATGTTGCTCCATGCA
TTTGAAGGCTACAATGTCTGTATTTTTGCATACGGTCAAA
CTGGGGCCGGTAAATCCTATACCATGATGGGCAAACAGGA
GAAGGACCAGCAGGGGATCATTCCACTGCTGTGTGAAGAC
CTTTTCACTAAGATAAATGAGAACAATGACAACAACATGT
CCTATTCTGTGGAGGTTAGTTATATGGAGATCTACTGTGA
GAGGGTACGGGATCTTCTAAACCCTAAAAACAAAGGAAAC
CTACGTGTGCGAGAACATCCGTTGCTAGGCCCATATGTAG
AAGATCTGTCCAAACTTGCCGTCATGTCATATAATGACAT
CCAAGACCTGATGGACTCCGGGAATAAGGCTAGGACAGTA
GCAGCCACAAACATGAATGAGACCAGCAGTCGTTCACACG
CTGTCTTTAACATCATCTTCACCCAGAGGCGGCACGACTC
GGAGACAGACAACACTTCAGAAAAGGTCAGCAAAATCAGT
CTGGTGGATTTAGCGGGCAGTGAGAGAGCAGACTCTACTG
GAGCCAAAGGCACACGACTCAAGGAAGGGGCAAACATCAA
TAAATCACTCACCACCCTGGGAAAAGTCATTTCAGCTCTG
GCTGAGGTGGACTCTGGCTCTAACAAGAACAAAAAGAAAA
AGAAAGTGGAAAGTTTTATTCCTTACAGGGATTCTGTGCT
GACCTGGCTACTGAGAGAGAATCTCGGTGGCAACTCTCGA
ACCGCAATGGTGGCTGCTCTCAGTCCAGCCGACATCAACT
ATGATGAAACCCTCAGTACTCTCAGGTATGCAGACAGGGC
TAAGCAGATCCGTTGTAATGCAGTGATCAATGAAGATCCT
AATAACCGTCTGGTGCGTGAGCTTAAAGATGAAGTGTCCC
GTCTGAAAGACCTCCTCTATGCCCAGGGCCTGGGTGACAT
CATTGAGATGACCAATGCTATGACTGGGATGAGCCCCTCT
CCATCACTCTCTGCCCTGTCCAGCCGGGCCGGTTCCATTA
GCAGCCTGCACGATCGCATCATGTTCAGCCCCGGGAGCGA
AGAAGCCATTGAGAGACTCAAGGAAACTGAGAAAATCATT
GCAGAGCTCAATGAAACATGGGAGGAGAAGCTTCGCCGTA
CAGAGGCCATCAGGATGGACAGAGAAGCACTTCTGGCGGA
GATGGGTGTTGCCATGCGTGAGGATGGAGGAACTCTTGGA
GTCTTTTCCCCAAAAAAGACTCCCCACCTAGTGAATCTCA
ATGAAGATCCCTTGATGTCTGAATGTCTTCTATACTACAT
CAAAGATGGGATTACCAGGGTGGGCAGAGAAGATGCCAGT
AGTCGGCAGGACATTGTTCTGAGCGGACACTTCATTAAGG
AGGAACATTGTACTTTCACCAGCACCACTGGACCAATGGG
AGAAGCTGTCATTCTTGAGCCATGTGAGGGAGCAGAAACA
TATGTAAATGGCAAGAGAGTCACAGAACCCACTGTTCTCA
AATCAGGCAACCGAATCATTTTGGGCAAGAGCCACGTGTT
CCGCTTCAACCATCCAGAACAGGCCCGTCAGGAACGTGAC
CGAACCCCCTGCGCTGAGACCCCAGTGGAGCCGGTAGACT
GGGCCTTTGCTCAGAGAGAACTGCTGGATAAACAGGGCAT
TGACATGAAGCAGGAGATGGATCAGAGACTGCAGGAACTT
GAAGATCAGTATCGCAAGGAGAGAGAAGAGGCCAACAATC
TACTGGAGCAACAGAGACTAGATTATGAGAGCAGGTTAGA
GGCTCTGCAGAAACAGGTCGATCGATGTTATCCTGACGCA
GCAGAGGAAGATGAAGAGCCTGAGGAGGAAGTGCAATGGA
CGGAGAGGGAGACGGAACTGGCAATGTGGGCTTTCCGCAA
ATGGAGATGTTATCAGTTTACATCCCTTCGAGATCTTCTT
TGGGGCAATGCCATCTTCCTTAAAGAGGCCAATGCCATTA
GTGTGGAGCTAAAGAAGAAGGTTCAGTTCCAGTTCGTGTT
ATTGACGGACACACTTTACTCTCCTCTTCCGCCTGACCTG
TTACCGCCTGAAGCAGCTAAAGACAGAGAGAAAAGCCCAT
TTCCACGCACCATTGTAGCTGTTGAAGTTCAAGATCAGAA
AAACGGAGCCACGCATTACTGGACCCTGGAAAAGCTCAGG
CAGAGACTGGATCTGATGAGAGAGATGTATGATCGAGCTG
CTGAGGTGCCCAGCAATGCTGTTGAAGACTGTGACAGTGT
GCTGACCGGAGGAGATCCTTTCTACGACCGCTTTCCCTGG
TTTCGTCTGGTTGGAAGGGCTTTTGTCTATTTGAGTAATC
TGCTGTATCCTGTGCCTCTGGTCCATCGGGTTGCCATCGT
CAATGAGAAGGGAGAAGTCAAAGGTTTCCTCAGAGTAGCT
GTACAGGCAATATCAGCCGATGAAGAGGCACCAGACTATG
GCTCTGGTGTCAGACAGTCAGGCACGGCCAAGATTTCTTT
TGAGGACCAGCAGTTTGAGAAGTTCCAGTCAGAGTCATGT
CATTCTGGTCTTTCGCGTGCTGCCGTTTCTCAGGAAGAGT
TGAGGATTGTGGAGGGTGAAGGACAAAGTGCAGAGATGGG
ACTGTCAGCAGATGAGGTCAACAATAATACATGTGCAGCT
AACCCAGAGGAGCTGGACAGCCCTGTCAAAACAGGTCTTG
ATGGGATGCTGGACGGCGCTCTGGATCACTTGAGGATTGG
TGAAGTCTTCACATTCAGAGTTACTGTTCTACAGGCGTCA
AGCATTTCCGCAGAGTACGCAGACATATTCTGCCAGTTCA
ATTTTATTCACAGGCACGATGAAGCATTTTCCACCGAGCC
GTTGAAGAACACTGGACGTGGTCCACCACTTGGCTTCTAT
CATGTGCAGAATATTGCAGTGGAAGTGACTAAGTCCTTTA
TTGAGTACATAAAAACTCAGCCAATCGTGTTTGAAGTCTT
TGGACACTACCAGAAGCAGCCTTTCCCTGCGCTCTGCAAG
GATCTCATTAGCCCATTGCGTCCATGCAGACGACAGTTCC
CAAGGGTCATGCCTCTTTCCAAACCAGTCCCTGCTACCAA
ACTGACAGCCCTCACTCGACCCACAGCAGGACCATGCCAC
TGTAAATATGACCTGATGGTCTTCTTTGAGATCTGCGAGC
TGGAGGCTAATGGAGACTATATCCCAGCCGTAGTGGACCA
CCGAGTAGGCATGCCTTGCCATGGCACATTCATGTTACAT
CAGGGCATCCAAAGGAGAGTTACAGTCACCATGGTACATG
AGACAGGAAGAGACATTGACTGGAAGGAAGTGCGAGAGCT
GGTTGTAGGACGTATCCGGAACACGCCTGAAGCAGATGAG
GCAATCATCGACCCCAATATTCTCTCTCTGAACATACTGT
CTGCAGGATACATTCGACCCGCGCATGATGACAGACAGTT
TCTTGATTCGGACATGCCTAGGACATTCTACCGGTTTGAG
GCTGCTTGGGATTCATCCATGCACAACTCTTTGCTGCTAA
ACCGTGTGACTCCTTACGGAGAGAAAATCTACATGACTCT
GTCTGCTTACCTGGAGATGGAGAACTGCACACAACCCACA
GTGATTACCAAAGACTTATGCATGGTGTTCCACTCAAGAG
ACGCCAAACTTCCAGCATCTCGCTCCATCAGAAACCTCTT
CAGCAGTGGCACCTTAAGGCCGTCTGAAGGAAACCGTGTA
ACCGGTGTGTATGAGCTCAGTTTATGCCACCTGGCTGATG
CAGGGAGCCCAGGAATGCAAAGGCGGCGCAGGAGGGTGCT
GGACACGTCGGTGGCTTATGTGCGAGGGGAGGAGAACCTG
GCTGGCTGGCGGCCCCGCAGTGACAGCCTCATCCTGGACC
ATCAGTGGGAGCTGGAGAAATTGAGCCTCCTGCAGGAGGT
GGAGAAAACCAGACACTACCTCCTCCTTAGGGAGAAGCTG
GAGTCCACCCTGCTGCTGGGCCAGGAGTCGCTGCTGTCCT
GCGGGAGTGAGGATCTAACCGAGTCCTCTTCCCCCTCCAC
TCACCTCGGCCTGGGCCACAACCCCGGCCCCGGCCCCGAC
ACACCCAATGAGAGGCAGAGGGAGCTGGCTGCTAAGTGTC
TGCGTTTGCTTAACCACACATTTAACAGGGACTACAGCCA
TGTGTGTGTTAGCGCCAGTGAGAGCAAGTTGAGTGAGATG
TCAGTGACTCTCCTGAAAGACTCTGCTTCAGTGTGTGCCG
AAAGCACCCTCACACCCTCCTCCACATGTCCTTCACTTGT
GGAGAGTCGATACATTCACAACACTGATCTCAGACCCCCA
ACACCCCGATCTCGTGCTGTGAGCCCTAATCCTGACTCTG
AAACAGATGGTAAGAAGATTCAAGAGCCCAGATCAAGAAC
CCGCACTTTTGTGCCAGACATTCAGGAAATCCGTGTCAGC
CCAATTGTGTCAAAGAAAGGCTATTTGCACTTTCTGGAGC
CCCACAGTAATGGCTGGGTTAAGAGATATGTGGTGGTTCG
TCGGCCTTATGTCTACATCTACAACTCAGACAGAGACACA
GTGGAAAGGGCCATTCTTAACCTGTCCTCAGCGCAAGTGG
AGTATAGCGAAGACCAGCAGGCCATGCTAAAGACCCCCTA
CACATTTGCGGTATGCACAGAGCATCGTGGGATACTCCTT
CAAGCCAGTAATGACAAGGAGATGCATGACTGGCTGTATG
CCTTTAACCCTCTGCTTGCTGGATCTATCAGGTCTAAACT
GTCCAGAAGGAGAGCTGGGCAGATGAGGTTTTAAGCCCAC
CACATGTGTACTCAATGTACAACTCTTCAAGGACAAAAAC
AAACACAAAGGACTAAACTTGTAAATAGAGCTACAGTACT
GACAGATTCACAAGTTTCTGTGCTTAATCAGCTCTCTGAC
CCTCTGTTTCCTTCATGTGTGTACCTGCACCTGTCCACAC
TCACGTCACCTGTGCACCTGTACATTTAAAGCCCTTTGTT
GTGCATCTGCAGTGGCCTAAATATTCAACTTATAGCGCCA
ACGGAACAGGCTAGATACTTCATTGGGTTAGATAGTTTGC
TTACGTAGTCTTCAACATTTAAGAAAGTTGGTGATGGGAA
CTCCTCATGCAAAACAAGCATCCAAATTGTTTCTGTGAAG
AGTGAAATGCATATCTTGAGTTTGGTGGATCACACGGCCT
TATTGTGTTACTTCTGACCTGTCAGTCTATGGGTTTAAAC
TGGTCAGAATTTAAGTCAGCAGACTATATGTTTATTCATC
TCTTGGCTATGGAAGATGGAATGGATCAACGATAAGCAGT
TCATAGCAAAAGGAGCAAATGAATCACGTCATATTACGCT
CTTACTCTCTTTAAGTGCAGTTCTTGGCCACAGTACAGCC
CGTCATAAATACCAATATACCTTTATAATGTTTCCATTGT
ATGGCCTTGAAAGCGTATAAAGTTTTCAAAATAATCAGGA
CGCATGAGGAGAAAATTGGCAACAGACGATGGTTGCACTC
TCATATCTCTGAACGAGAACCATTAAAAAGATTTGGCCTA
TTTTTGTTGGAGTACTGGTCAGTAGATTTATCTCAAATGT
ATCATAATCCAGTCTAATATTTTATATAAAAAGTATCGGT
ATCCCCAAATGATCTTATATCTGTCTAATTTATTTTTAAG
ATTTCTGTTAAAGTCTTATCTAGCTAGCTATTTATTTAAC
GTGTTTTTATTTATTTTAGCATCTATTTATTGAAAAAGAC
TGTAATATTTTTGAAGAAGTACAGTGCAATTTCTGCATAT
GGCACTTTTTTTTTAATCTTGAGTTGAATGACCTCCATTT
TACTGACTGCACTGCTCTCATTCCCCCCGACATGATGAAA
TGCATTTGGGGATCAGGTTAGAAGTGAATGCTGGGATAGC
TGCTATTACAAGTAGATTACTTGAATTTCACTTTTTAGTT
AAAAAAGTCGTTCATTATTATTATTATTGTTTCATTTTAA
AAAAATCATCATTATTGCCCAGGATCCTAAAAGAGTGCTT
TGTATGGTGGTCAGTCTTGAAAGATGAAAAGTTTAGCAGT
TGATCAGGTCATACGTGCACAACTGATGGAATTTTCAAAG
TGCATCCCAGAGAGTGATGAGATATGATTTTGTGCCTCTT
GCATCATTTTTTTCAATGTACATCATCTTACTGTATTTCC
TGTTTGCTTCTTTAACAGGATGAATGTCTACTTTCAGGCT
CACTCATCATTACCATTGTTTCTCTATGTGTGCAACCATA
CAGTACCTGTCCACGGGCAACAGCAGGTTTTCAGTTACTT
TAATTTGCATATTAAGTTGGCATAGTCTACTGTACATTCC
CTACGTATAGGATTTCTAAGAATATCTAGATAGTGTAAAT
ATTGTTTTGCTCAAGTTCTTTAAAATGAACAAAAACAAGT
GTATTTATTTAACCAAAAACATTTTTTTCAGCATCATACT
GTAAACTCAAGAAATAAGCCCTACTTTCTTAGTAATGTAT
TGAAGATCTGTTTTGACTTTTTGTTTTTGTTGGAAAATGA
TAAATCCATTTTGTTTAGAAATTCTTGTAATCCGTTGCAG
TGTAGACTGACTGAAATGCAGACTTTCAGCTACAATCACT
CTGAGACTGTTGCAAATTGCGTTTTGGTCCCTGATTCATG
CACAAATGGTCACATATCATAATTTTATACTGAATAGGAC
AGAGAACGTTTTGCTGAACGAAACACCAGTCTGAATGAGG
AGTGTTTTCATTCTTAACCACCATTTTAATACTTAAACAC
ACTACTATAAATGCAGCCTACATTGGAATGAGAACATTCC
TTATCGAGACTAGTGTTTTTACTTTTATTCATACTTTACT
GTTTTGCTAGCGTTCATGTCCTTAGCCTACAGGTTGCGTG
ATGGTCACATGTGGTGCTTGACGAATCAGAGAGCAATACA
CAATAGTCCAGAAGATCAGTCAGAGTGCAAATGTGGATAG
CTGCAACTCCATTTTTTGCAGTTTGAGTTTCGGTAGACCT
GTACTGAAATGGACCATCAGCATTTTCAAAGTAAAACATG
CTCTTTTTACATATCAAAATGCCTTGTTTTTCATAGGCCA
ACGTTTCCAGAGTACAGTGGATGCCAGACAAAATAAGACA
GATATATGAAAAGACGTGTGTAAACGAAGTGTAAACAGCA
TCTCAGGTCTGACTGTGTTCTGATTAGGTGATGTTTACAC
TAATGTGTTTTTGTTTTGTTATAGTACGTCTGGTTCCCAC
ACTACTCTGACCTTTTTCACCTCTGAAAACTGAGCATTTT
AAAAATACTGAAGATCTGTTTTAGTTGTAGAAATGCTGGC
ATTCTGTTTCAGTGTATACCGACCAAAATGCAGCCTTTTG
AAATGGAGGCAAGGCTATAACTGCTCACTGTTCACTAGTC
TTTCAGACCATTGCATATTGTTCCCTGTATCATTAAGCCC
TTCTCATATGACCGTTATTCAACCGGTAGACTGTAAGTAT
AGATGTCGGCAAACAGTCAGTGTGTAAAGTCACTAATCAT
GTGTTTGGCTGTACAGTGTGGACAGAGATCAGATTTTTAG
AAACACAATAAAAAACACTTTTCTGGACACCACTTTAAAA
CAAAAATGCACTAGTGTAAATGCCGCCTCAATCTCAATTG
ATTTATCTTGCGCACAACTATCCTGGAGTTTACCTGAGAA
ATATTTTTGCATGTTCAGAGCACAGATCAGATGTTCATCT
GAGGTTCCTGCAGAGCTGGATCTGGCAGCTTCATGGGAAT
GACTGAGGTCAACCAACCTACAGTTCATACTCAATACTGC
AAGAAAACACCTCTGCTAAAACACTGATCTGTCTGTGAAT
AGATTCCAGAGATTTAAACTTCTTATTCCAAAAATTCAGT
TATTACTATTGTCATTTCTGTATCTTTGAGTGGACAAAAT
AAGCATATCTTCAGTTTTTCACTGATATGTCAAGTCATTT
CACTTTACATTTATGACCAGTTTAAAATAAATACAAGCAA
TGCCACTACTTTTAGAAACATACATACCTTAATAATAATA
AGTTTGTATGTGTGTGACAAAATTACTTTTTAAAATTAAT
TTCAGTTAAAGTGCTTACTAGATTGTTTTCATTTTTGTCT
CTACAGAAAGTAGGACAGAGAGCTAGAAGTATAGCATATC
CTGTAATGTTTCTACAAGCTTTTTCATAAAACACCCATTC
CATTATCATTGAATTAATTTACCACAAGTAAAATAATTCA
ATTGTTCTCATAATTTACACCAAATATTTGTGTGCTTCCG
TTCTGCTTTAATGCACATTATGACTCCATTCATATGATTT
TTTTCTTCTCTGTTGTTCTCTCTGAGTTTTACTTGCCTTG
TATATAAACATGATTGCTGTGAATGGTGTATAATGCAGTT
GTAATTGGTTTGTACCATCTTCAGTGGGCAGTAGTTCAAT
GTCTCTTTCTGAGTGTTGGAGTTATGAGTCATGTTTGTGT
ACACTTAACACATTGTCAGATATGAAATAAATGTGGAACT
TATGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations