ZFIN ID: ZDB-TSCRIPT-131113-2060
Transcript Name: abhd5a-001
Previous Name: ch73-269i6.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054180 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054180|OTTDARG00000037856|ZDB-GENE-070615-1 abhd5a|no_translation CH73-269I6.2-001 LG_ CU856516.14 Danio rerio lincRNA NOVEL, 529 bp
TGACAACAGAGTCACAGAATACATCTACCATCTTAATGTC
CAAAGTCCAAGTGGTGAAACAGCCTTTAAAAACATGACCA
TTCCATATGGCTGGGCAAAGAGGCCCATGCTGCAGAGAAT
TGGCCTGATTCACGACGACATCCCCATTACCGTGATCTAT
GGCTCACGCTCCAGCATAGATGGCCACTCCGGCAATTCAA
TCAAAGAAATGAGGCCAAACTCCCATGTCGAGATCATTGT
CATACGAGGTGCCGGACACTATGTTTATGCTGACCAGCCT
GAGGATTTCAACCAGAAGATACTTCATGTCTGTGATACAA
TAAGCTGAATAGGGATGAAGGTATATTTTTCTTCTGGAAC
TATCCAAACAGAGCTTATGGTGTCTCCACATTGGCTCATG
CATGTCAACACATGATCTTCGTTGCATATGAAATTTGGAC
TGGAGATTTGGGAAGCCACTGGGTTTGAAAACCACATGTT
TTGCACCACTACTGGACTTTTTTGAAGCATTTGTGTTTGT
GTGTGTGTG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abhd5a-001 Contained in:
[BAC] CH73-269I6 (1)

Genome Resources: Vega_Trans:OTTDART00000054180 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CR927938 (1) 529 nt
CITATIONS (1)