ZFIN ID: ZDB-TSCRIPT-131113-2053
Transcript Name: baiap2l1b-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054106 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054106|OTTDARG00000037812|ZDB-GENE-050417-371 baiap2l1b|OTTDARP00000042506 baiap2l1b-001 LG_none CU464205.7,FP340292.7,FO082037.5,FP340264.8 Danio rerio protein_coding KNOWN, 2081 bp
TTCAGACGGTTTCATCGGGAGGTTATTGCGGAGTTGGAGA
GGAAAACAGACATGGATGTGAAGTACATGACGGCCACGTT
TAAGAGATATCAGACGGAACACAAGATGAAGCAGGACTCG
CTGGAGAGATCACAGTCAGACCTGAAGAAGGTCCGGAGGA
AAAGCCAAGGGAGAAACGCATCTAAATACGAGAGTAAAGA
GAATGAGTGTCTGGAAACACTCACCCACCGTCAGATGGAC
ATGCAGAAGTTCATCGCCGACGGCTGTCAGGAGGCTCTGC
TGGAGGAGAAGAGAAGATTCTGCTTCCTGGTGGACAAACA
CTGCTCCTTCTCACACCAGGTCTCCGCTTTCCATCAAAAG
GCCCGAGAGCTGCTGTCGGATAACCTGATTGTCTGGCAGG
AGAAATGCAGCGACGCCACCAATGTGCCGGACAGTGTGTT
GAGCATGATTGAAGGCCTGCGGACACCAGTGTCAAACACA
CCGCAGCCGTCTCCATCACTGCAGCGCCACAGCAGGGCCA
ACTCTGAGGCCATGATCCCTGCGCCCCCCGCCCCGCCGCA
GACCAGTCCACTGGCCAACATGTTCAGCCAGCAATCCTCC
AGACCGGACAGTGATAGCGACTACCTGAATGAGGACAGTG
GGTTGTCCCGCTCGGTGTCGATGGCCACTGGACTCAACCA
CATAGACAAAAGGCCTAAAGTGCGCACCATCTTCCCTCAC
AAGTCTGGAAACAACAGCACACTGCTGAGCTTCGAGGAGG
GAGACGTCATTACACTGCTGATCCCTGACGAGAGAGACGG
CTGGCTGTACGGAGAGCTGAACAACACCAGACAGCGGGGC
TGGTTTCCATCATCTTACTGCCGTGCATATACAGAACCAG
CAGTAAATAACAGTATGGTTGGACTTCCTCCGATGCGCAG
TAAAAGCGTGGCTAATCTGATGCAGCAGGAGCCAGCGGAG
GACAGGATGGTTCTTCCTCCAGCAGATTATGGAGATTCAC
CGGTCAGGAGGAACTCCACCAAGAGCCTGACGCAGACTTA
CACCCCGTCATTGGAGAACTCGGGTCCACAGTCAAACGGC
CTGCCAAAACATCCACTCCTAGGGGGAGGAAATCCATTCG
CCACGGTCAAACTCCGGCCCACAGTCACCAATGACAGATC
AGCCCCGATCATCTGACCGTCATTCAGTACAGTCACACAC
ACACACACACACACACACACACACACATGCACAACACTAT
TTATGTGAGTCACTTTTAACCCTTCACCTCCCTCTCTCTC
TCTCTGCTTCATATATTTCTACAGATTTATATTTACACTG
CAGAAATGCTCTTCTCACTGAGAGTTTTGGTCTTAGTTCT
ATTAAAACTATCTAAAACTCTGAAATCAAGAAGCATTTTG
GAGAAAAAGCTAAAATATAGTCTTGTTTTTAGTAATAATG
AGTCAAAATGCGATGACTTTTTACTTGAAACAAGCTGAAT
AATGCATCAGTTGGCGAAGAGAAATAATCTTAACGTCTGA
TCCGTTTATTCCCCCCATTAGCGGATTATTCAGCTTGTTT
TAAGGTTGTATTAGTTAATAATAGTTCATGTATTTACTAT
AGTGGACAAACAATGAGCAAAACACTTACTACAGTGATTA
TTGATCGTTGTTAATGCAAATCAACTCATGTTAACAAGCA
AGACATCAGATGGTAATAATGCATGAGCACATGCTGAAGT
ATGATCAGTAAATGCTGTTCAAGAACTGTTAGCTAATCCA
GCCTTATTGTAAAGCGGGACTAATAATCATGATTTATTAT
TTGTTGTTTGCTTGTTGCTTACATAATCTTGCTTTTTCTA
GAAAATGCTTCCTAATTTAGGAGTTTATAGGTACTTGGAC
TGGAAACAAGACAAACTCTCTAAGTAAGAAACACGCTTTG
TTGCATTGTGTGTGTGTATAGAGAGAGAGAGAGAGAGAGA
GAGAGGAATCTATTGAGGGAATGATTATGAATATGCATTT
AGTCCTACAGATCAGGTAGTTGCGCTTTTAGTGTATCATT
TTGTAAATACAGAAGAGAATAAATGTGTGATCTGAACTTT
T

baiap2l1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA baiap2l1b-001 2081
baiap2l1b-002 (1) 450
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
baiap2l1b-001 Contained in:
[BAC] DKEY-111K8 (1) (order this)
[Fosmid] CH1073-190D17 (1), CH1073-462N6 (1)

Genome Resources: Vega_Trans:OTTDART00000054106 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC092786 (1) 2603 nt
GenBank:CA974969 (1) 902 nt
GenBank:CK237434 (1) 749 nt
GenBank:FP198003 (1) 606 nt
GenBank:FP198007 (1) 580 nt
GenBank:FP192235 (1) 559 nt
GenBank:AL913787 (1) 531 nt
CITATIONS (1)