ZFIN ID: ZDB-TSCRIPT-131113-2042
Transcript Name: si:ch211-165g14.1-201
Previous Names: ch211-165g14.1-001, si:ch211-165g14.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054033 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054033|OTTDARG00000037761|ZDB-GENE-131127-601 si:ch211-165g14.1|OTTDARP00000042452 CH211-165G14.1-001 LG_ AL772300.10 Danio rerio protein_coding PUTATIVE, 5235 bp
ATTGTGCTGCGCGTTCCGGTCGCCATGTTTAGCCGGATTC
ACTCAGTTAAACAGAGGAACTGCCTTGTCCTGCTGTCGCC
TGTACTTTTACTCTTTTATAGGATTTTAGACCAGATTCAT
TTTTAAAATAGCCGTGCCTTTGGAAACATGTTGCGGCAGT
GAAGGGACGCGCTATTCCTCTGTTATGGACCCTCATGACC
AGGCTGACGTCATGCACCTTCAGGACTCTCGTTCCTCAGC
TCTGGATCTGTCGGTGGGCTGCAGGCATACAAACCCAATA
GAGGCTCTGGATCTGGTGAAGAAGCCTAGCTGGTGTGGCC
TTACCTCAGGAAGCAGGAGTGTCAACCTGTCAGAGTCCTG
CTACATCGAACAGACTCCACCCCATCGTCCCGAGCCAGGA
GAGACACCAGCCCATGACTCCTACTCCATCCCCTTACCCC
TAATCAATGGCATGCCCTCTGTGGCACAGATACTGTCCCA
GTGCTCATCCACAGACCAAGAGTTTACAGATTGTCATGAG
GAAATGGAGGAAGAAGAGGAGGAGGAGGTGTTGATGCAAA
CTAAACAGTGTCACAAGAACGCAGAGTCTGTGCTGGAAAA
CAGCATTCTAGGAGGTAGGATAGCGCACGTCGTATTAGAG
AAACATCCACAAGACATTGGGAGTGACACAGTTTTTTCTA
AGGGCTCGTCATTTTTACCTCAGGACTCCAGTGCTGCTGC
GAACACACTTCACTCCACCAGCTCAGCAGCAGAGCAGACC
GCCATCGAAACCCTCGCATCCGAATGTACAAAAACATCTA
CCGAGAGCACCTCCAGTGATGCCGACAGTGACATCATTGA
GGTTCCAGTAAGCAACTCTAGATGCACAACCCGCCCAAAC
TTGCGTCCCCGACCAACAAGTGTTATAGTCAGCGATACAA
GCGGCCGGACGCTCAGAAGTTCCCGCTTAAAGCAGCAGGT
TGATGCTGATCATCAAATGAACTTCTCTCCCAAAAATGTG
AACAGCGTCTACACTATGGATGAAGCCGTTTTTGAAACCG
CCAACCATAGGGTTGGCTCCGAATCCAAATCGCTGCTGTC
TTGGATGGAGTCAGTGTTGATCCCCATTTCCCCGGAAGAC
AGCGAACAAGACACCAATTCTTCTTTCCCTAAAAACTTCC
CATCTACCTCCGATGCAGAAAACTCAAGCATCTTAAGGTC
TCCAGAGAATCGGAGATCATCATCTTCAACGCCAAGCCAT
CAAGAAAGGACTCCACCTTCGAAAAGCAGGAAACGGGCAA
AACCAAGGCCCAAACCGAGACCCAAACCAAGACCTAAACC
CAAGAAACAGCCGAAGAGAGCGGCGCCAGGCCCCAAAACG
ACGAAGAAAAGACGACGGAGGAAACCTCAGCCATCAGGAC
CGTCATCCATGTTTTCTCCTAAAGAGCCGGAGATCAAACT
AAAATTTGCAAATCACAAAAGCGAGAAGAAAGAGGTTCGG
ACTGCCGTTCACTGCTTCGTGCCGTACATTCGTATGGAGT
TCTCGTCCTGCACAATTGTCAATTTTAGGGAGGAGGAGGT
GGCCTCAAAGAAAGGCTCCCAGCTTGCAGACTCAGGGGTC
ATCCCAAAGACATCCTGTCTACAGCTGGGTCGCATTGGCT
CTGACGCCAGGCTTCAGGAAACGCGTTTTTGCTGCCTGTG
TGGAAGTACTGGGAATGTTGAGGGTCTTGGGGATTTACAT
GGACCGTACCATCGCAGTGGAGCTCACCCCGTCTGTAAGG
TTGACAGCAGCCTTCCTCTGGCCTTAAAACAAGAGCCCGA
CTGCAGCGACGTGGACTCGTTGGACAGTTTAGAGGACGGT
GGGTCTCAAGTCAAACGACGGAGGAAGGAGAACGGCTGCG
AGAGTCTGGAGGAGTCTGGTGCGCCTGGGGAGCACTGGAT
ACATGAGGACTGTAGCATCTGGACGGCAGGCGTCTTTTTG
GTTAAAGGGAAACTCTACGGACTGGAGGAAGCAATCCGGC
TCGCGCAAGAATCAGTTTGCTCGTTCTGCAACAGGGTTGG
TGCCACTTTGGGATGTTTCTTCAAAGATTGCCCTCAAAAA
TACCACTTCCCTTGTGCCGTGCAGTCAGGCAGTGCTCTCA
ACGAGGAGAACTTCACCATGAGATGCCCCAAGCACAAGAA
TAAAGTGTCCAGAATGAGCGTCAGCAGACTGAAGAACAGA
TGACGTTTGGCAGGAGTTGAGATATCTTTGAAGGCAGACT
TCACCAGACATGGGTTTATCCGGCTGTGGAGCAGACGCCT
GATGTGTTTACAGCTGATTTTTGTACTTCACATGTACGTA
TGAGTGTTTACACGTGCTCTCAGGCAGATAGATGAATGTT
GGGACTGGATGTGCTGTTTTGAGACGCCGCTGGCTTTTTT
TTTTTCATCTGGCACTACAGCGGTACCCTCGGATGATTGA
TGCTGGATGATCTTCATTACATTCCTCAGTGTTAAAAGCA
CTCACAGTTTTTTTTAACCATCAACTCTCTTGCATTGACT
CTAGGCCAAACATCTCCATCTTTAGACTGAAGCACCTTTG
GTCATGTCTACACAACAGTGACGTCATTAATAATACCCTC
GAATCATCTGAAGAAGCAGGATGTGCTTTATTTTTTAATT
TTCTCCTTTATTTATAGTCCTGAAGAAGAGCTTCAGATGA
TTAGTGCTGTTAGACATGCTGTCCAATCTAAATCAGTGCT
GTCCTCATCACATAAAACTGAAATGCTGAGTGAACTCCGG
TGGTACCGTATGCACTAATGAGTGAGCATATTTATTTCTA
TTTATGTTTAATGCATATGCGTCTATTTATTTGCCAATGA
ACAGCCTCCTTCAAAGAGACAAGAGTGTGTTTTAGCACCT
TGTGTGTCCGCATTAAAGGAGCCGTTGTGATTTAATGTCG
TCGGTAACAGCTACAGGGTGCTTTGAATATGAATTTCCGT
CGATTCGTTTAAAACGCGTGGCCTGAATCAAGCAGTCGCA
GTGTCTGTAGGGTTTCCCCATTTCACCTGATGCCTTGTGA
AGTCTCCAGTTCTGTTTCAATAAATGTTTTTATTCTACAT
TCCTACCATTGTGTGCGACGCTCCCTTCTTTTGGCATTGA
TGTGTTGATGCACTGTTTGTCCTGGAGGTGGTGCTGAACA
ACCTTAATGTGTTGATGTCTGTTTTACAGCTGATGAATCT
TATTCACAGGCAGCCACTGCTTATTACTAAATCAGACTGA
TGGGTTTAGGAAGTTTGAACCTTTTCATCATAGAAAACAT
TACAGTGGTTTCCACAAATAATTTTAAATCAGCTGCATAA
CCTGAGCTCTCATATATACTGTAGTGTTGAAAATGTGCAT
ATTTGAGTTTAATACAGACACTATTGAAGTTCTAAATAAA
TGAATTCAAGGTTTTCCTGTGTGGAGGTTCTTCTCTTGTA
TCTAATAAAAGAAAACAAATCAAAAAGCATTTTTAATCAT
TTTAGGTTGTTTTGCTGACACCACTGGCAGATTTTGCTTG
TTTTAAGGACAAAAACTGTAATTAAATTTTTTTCTGGCAC
ATTTTGCTTGTTTTAAGGACAGAAAAAAAGTAATTTGTTG
TCCTTTAAACAAACTAAATCTACCAGAAAAGGGTTAGAAT
TACAGTTTTTGTCCTTAAAACAAGCAAAATTATGTTTTTT
TTAGTCTTCAAAACAAGCACAATCTGCCAGGAAAAAAAAA
AGTTAGAATCAGTTTTTGTCTTCAAAACAAGCAAAATCTG
CTAGAAAAAAAAGGTTAGAATTACATTTTTATTTGTCCTT
AAAACAAGCAAAATAACAGTTTTTGCTTGTTTTAAGGACA
ACAATTGTAATTCTAACCCTTTTCTGGAAGATTTTGCTTG
AAGCAAAAACTAATTCTAACCTTTTTTTGTCAGATTTTGC
TTTTTTTCTAGCAGATTTTGCGCAAAAAAAGTAATTTTGC
TTGTTTTCAGGACAAAAACTTTAATTTTAACTTTTTTTTG
CAGATTTTGCTTCATTTAAGGACAAAAACTGTAATTCTAA
TTTTTTTTCTGGCAGATTTTGCTTGTTTTAAGGACAGAAA
AAAACATTTTTTTTGTCCTTAAAACAACCTAAATCTACCA
GAAAAGGGTTAGAATTACAGTTTTTGTCCTTAAAACAAGC
AAAATTATGTTTTTTTAGTCTTTGAAATAAGCACAATCTG
CCAGGAAAAAAAAAAAGTCAGAATCAGTTTTTGTCTTCAA
AATCTGCTAGAAAAAAGGTTAGAATTACAGTTTTTTTTTG
TCCTTAAAACAAGCAAAATAATCGTTTTTGCTTGTTTTAA
GGACAACAATTGTAATACTAACCCTTTTCTGGAAGATTTT
GCTTGTTTTAAAGCAAAAACTAATTCTAACGTTTTTTGTC
AGATTTTGCTTTTTTTTCTAGCAGATTTTGCGCAAAAAAA
GTAATTTAGCTTGTTTTCAGGACAAAAACTTTAATTTTAA
CTTTTTTTTTTTTTTTTTGCAGATTTTGCTTAATTTAAGG
ACAAAAACTGTTATTCTAATTTTTTTTCTGGCAGATTTTG
CTTGTTTTAAGGACAGAAATTTTTTTATTTTTTGTCTTTA
AAACAACCTAAATCTACCAGAAAAGGGTTAGAATGACCGT
TTTTGTCCTTAAAACAAGCAAAATTATGTTTTTTTAGTCT
TCAAAACAAGCGCAATCTGCCAGGGAAAAAAAAATTGAAT
CAGTTTTTGTCTTCAAAACAAGCAAAATCTGCTAGAAAAA
AAAAGGTTAGAATTACAGTTTTTTTTTTTTTTTGTCCTTA
AAACAAGCATAATAACCGTTTTTGCTTGTTTTAAGGAATT
ACTTGTTTTAACTGTAATTCTAACCCTTTTCTGGAAGATT
TTGCCTGTTTTGAAGAAAAAACTAATTCTAACCTTTTTTG
TCAGATTTTGCACAAAAAAACTATTTTGCTTCTTTTCAGG
ACAAACTTTAATTTTAACTTTTTTTTTGCAGATTTTGCTT
AATGTAAGGACAAAAACTGTAAATCTAACCTTTTTCTAAC
AAATTTTGCGCAAAAAAAACTGATTTTGCTTGTTTTAAGG
ACAAAAACTGTAATTCTAACCTTTTCTGGCAGATTTTGCT
TGTTTAAAGGACAAAAACATTTATTTCTATTTCTGTTTAA
TGCATATGCGTCTATTTAGCACCTTGTGTGTCCGCATTAA
AGAAGCCGTTGTGATTTAATGTCGTCGTTTACAGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-165g14.1-201 Contained in:
[BAC] CH211-165G14 (1)

Genome Resources: Vega_Trans:OTTDART00000054033 (1),  Ensembl_Trans:ENSDART00000154122 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH432508 (1) 1017 nt
GenBank:EG570778 (1) 921 nt
GenBank:EE717166 (1) 918 nt
GenBank:CV576364 (1) 727 nt
CITATIONS (2)