ZFIN ID: ZDB-TSCRIPT-131113-204
Transcript Name: lgals3bpb-201
Previous Name: lgals3bpb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049940 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049940|OTTDARG00000035136|ZDB-GENE-040426-2262 lgals3bpb|OTTDARP00000039192 lgals3bpb-001 LG_ CU570690.8 Danio rerio protein_coding KNOWN, 1994 bp
AGATGCTTTGTAAGTCATTCAGTTGTGAATTGCATCCTTG
TCGTTGCTGTTTCTGACATCATGTTGCTCCTGTGGCCTCT
ACTGTTTCTTCAGGTTTCTGCACTGCGCCGGACCTTGTTT
GACCGACCAAAGCAGCTAATGCAGGAGGGAAGAGTGAGAC
TGGTTGGAGTTATTCCCTCGTCTGGCCGTGTGGAGGTCTA
CCATGATGGACAGTGGGGTACGGTCTGTGATGACGGATGG
GATCTGGCCGAAGCGCAGGTGGTGTGTCGTCAGCTGGGTT
TTCCTGGAGCCGTATCAGTTGCTACTGGAGGACAATATGG
TGAAGGATCTGGTCGAGTCTGGCTGGATGATATGAACTGT
AAAGGCTCAGAGAGCTTATTGTCTGAATGCAGCTTCAAAG
GCTGGGGTGTTTCTGACTGCACGCATAAAGAGGATGCAGG
AGTGATCTGCGCGCCTGGTAAAAACACAACCAGCATTCGA
CAGATGTCTGTGGACAACAGTCTGGGATTGTCAGATGATC
TCGGTCTTCTGTTTGACAGTGAAGACGGTTGCGATTTCAC
CATTGCTGTTCGAGATCTCAGTGAAGAGGCTGAATTGACT
TTTTGTGTGCACCGTGTGATCCTCATGATCTATCCAGAGC
TAAACTTAACACATGACACCAGAAACATCACGGTGGACAT
CAGCCAGACTTGCCATACTCATGTGCCGAGATTTCTTAGG
TATTTGTACACCCGTCAGATTGATGTCTCTACAACATCCG
CTCAGTGTCTCCATCAGCTGGCGTTCATCTTTGGAGTGCA
GAAGCTCATGGAGGATGTTGGCAGGGTCTTCACTGCACTC
ATTCCTGAAGACATCACCTTCCAGACGCAGGTGTCAATGT
ACGAGTATGGCGTGCGCACGGGTGACCTTGTCCTCCAGGA
GAACGTTCTCCAGTATCTTTCCTGGAACTGCGAGTTCCTC
ATAAGCTCTCCAGTGTGGAGCACCGTCTCCTTTGACATGA
TGGATGCTCTGCTTCAGCGCTCAGACCTGATTGTGAAGGA
TGAAGCTGTTCTTCTTGAAGCTCTGGAGAGATGGATCCAA
GACAAAGGTGACAAGATTAGTTCAGATAAACAGGTCAGCC
TCCTGAATCACATCCGCTTCCTCTTAATCCCGGTAGATAA
ACTCTATGACATCCAATTCTCCTCAAGTGCTCTCCGGCAG
AGTAATGAGAAACTGTATCTGACTGGACTGCTCAGAGGTT
TTCAGTTCAATGCTCTTCCCTTCTCTAAGATCAGAGATCA
AGTTGTTAAATTGAGCGGTAATTATATCCCCAGAATCTAC
ATTGGAGATGAGTGGAGTCTCGGTTTGAATGTGAGCACTG
TCAATAACCCACATTACAACCCTTATCAGTATGGATATGA
CCAAAGGTATGGCCAAAGTAACAGAATAGAAAAATACTTA
TCCACTCCTGCACACCCTAGTGCTGTGTACAGAGGGCAAA
TGATCCAGTGGCAAGCCCAAGTTTTCCGTAGTGTTCAGGA
CTGCCGAAATAGTGGCATTTCATGCAATTCGGTGCCTCTT
GTAAGATTCCTCGCAACTAGCAGTCAGTACAGTTACTCCA
GCACCATTCGCTACAACAACCGGTTGGTTCTTACCTGTAA
AAATCAGAACAATGTCTTCCATGTGCAAGACTTCAAAAAC
AACATGGCAGTGATTCCAACTAACAGCAGCATGGGTCTGC
CGAACCCCTGTCCAGATGACTACAGCTTCAGATTTGTCGT
GCGCCCACAGTACATCTGAATGCTCAGCGATTTGACCTTT
GAGTTTCAGTTGAATCAATTCTGCTAAATTAAATCGAGTC
TCTTTGTATTAAAAATCGTTTTCATTCTTGAGTGATTTCT
GTGATTTGTTTTAGTTGATTTTAAACCTTTCATTACTGTT
AATTAAAAATAAATATGCTTAATTTTCATGCTTAGTGTGC
GCATCAAAGACAAAATAAAAAGGTTCTTTCATTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lgals3bpb-201 Contained in:
[BAC] CH73-274N20 (1)

Genome Resources: Vega_Trans:OTTDART00000049940 (1),  Ensembl_Trans:ENSDART00000101829 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC066712 (1) 1983 nt
GenBank:EH580957 (1) 922 nt
GenBank:CO806756 (1) 798 nt
CITATIONS (2)