Transcript

ora4-201

ID
ZDB-TSCRIPT-131113-1957
Name
ora4-201
Previous Names
  • ora4-001
  • zfos-1324h11.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052685 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052685|OTTDARG00000036975|ZDB-GENE-100721-6 ora4|OTTDARP00000041416 ZFOS-1324H11.4-001 LG_ CU914780.13 Danio rerio protein_coding NOVEL, 513 bp
CATGTCTGAGGTCCTGACGGTGGACGCGGTTCTCTTCGGC
CTGCTGGTGTTCTCTGGTATCATTGGAAACATCATGGTCA
TCTATGTGGTGTTTGACTGTGCTAAATTGTGCGCCTCTCG
CCACCTGCCGCCGTCTGACACCATCCTGGTGCACCTGTGT
CTGGCTAACCTGCTGACGTCAGTGTTCCGCACGGTGCCGA
TCTTCGTGTCGGACCTGGGCCTGCAGGTGTGGCTGACGGC
GGGCTGGTGCCGCGTCTTCATGCTGCTGTGGGTGTGGTGG
CGGGCGGTGGGCTGCTGGGTCACCTTGGCTCTCAGCGCCT
TCCACTGCGCCACCCTGCGTCGCCAGCATGTCTCCATGGG
GCCGCTGGGTCACTCGCGGGAGCGTCGCCGCGTCTGGGTC
GTCCTGGCGGTGGTGTGGGCTGCAAACCTGCTGTTCTCGC
TGCCGGCGCTGGTCTACACCACACAGGTGCGTGGGAACGC
TACGGTGGAGCTGATGGTGATTAGCTGCACCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations