Transcript

chdh-201

ID
ZDB-TSCRIPT-131113-1953
Name
chdh-201
Previous Names
  • chdh-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052627 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052627|OTTDARG00000036937|ZDB-GENE-120111-1 chdh|OTTDARP00000041365 chdh-001 LG_ CU638702.4 Danio rerio protein_coding NOVEL, 2006 bp
GGCTACAGAGGAATCCTTCTTCAACATCTCCATAGGTCAG
CTGTGCGGACACTACAGCACTGCACGGCTGCAGATGAGTA
TCAGTGCATTGCTCTGAAAGCTGACCGCTCTGACATCTCT
ATCATCTCCATCATCTTCATCATCTCCATACTCTCCATCA
GTATGGCGTGTTTCTCCTCCTCGACGAGGCTCATGTCCAG
CCTCTGCAGTCCACTGCTCCATCACAGGTACATCAGTACC
GTGGTAAACAAGAATACACCGTCCTACAGCTATGTGATAG
TCGGGGCCGGTTCTGCGGGCTGCGTTCTGGCCAGCCGGCT
GACGGAGAACCCATCCGATTCTGTGCTGCTTCTGGAAGCG
GGACCCAAAGACAAGCACCTGGGCAGCACACGTCTGTCCT
GGAAGATCCACATGCCGGCCGCGCTCACATACAACCTCTG
CGACGACAGGTACAACTGGTTCTACCACACGTTACCTCAG
GCCCACATGGATGACCGTGTGATGTACTGGCCCCGCGGGC
GTGTCTGGGGCGGCTCATCCTCACTTAACGCCATGGTGTA
CATCCGGGGACACGCAGAGGACTACAACCGCTGGCAGAGT
GAGGGTGCGGACGGCTGGAACTACGACCACTGCCTGCCGT
ACTTCCGTAAAGCACAGACACACGAGCTCGGACCTGACCG
GTACCGCGGAGGAGACGGACCACTGCACGTGAGCCGAGGG
AAAACACAAAACCCTCTGCACTATGCATTCATCCAGGCGG
GACAGCAGGCTGGATACCCCTACACCGAGGACATGAACGG
GTTCCAGCAGGAGGGGGTCGGCTGGATGGACATGACCATT
CATAAAGGTCAGCGGTGGAGCACAGCGAGTGCGTACCTGC
GGCCGGCGCTGTCCAGACCCAACCTGAGCACAGAGGTACG
CTGTATGGTGACGCGCGTGCTGTTCGACGGAGCCCGCGCT
CGAGGAGTCGAGTACCAGCAGAACGGACAGATCAAAAAGG
TGTTTGCAGAGAAGGAGGTGATTCTGAGCGGCGGCGCCAT
CAACTCTCCACAGCTCCTCCTGCTGTCTGGAGTGGGAAAC
GCAGATGAGCTGAAAACCCTGGACATTCCTGTGGTCCAGC
ATCTGCCCGGTGTGGGCTGTAATCTGCAGGATCATCTAGA
GCTGTATGTTCAGCATGCCTGTACTCAGCCCATCACTCTC
TACAGAGCCCAGAAACCCTTACAGATGCTCAAGATCGGCC
TCGAGTGGCTGCTCAAGTTCACAGGTTACGGAGCGACGGC
TCATCTGGAGAGCGGAGGCTTCATCCGCAGCCGGCCCGAT
GTTCCTCATCCCGATATTCAGTTCCACTTCCTGCCCTCGC
AGGTCATCGATCACGGACGCGTCAGCTCCAAGATCGAAGC
CTTCCAGGTTCATGTCGGGCCCATGAGGAGCACCAGTGTC
GGCTGGCTCAAACTCAAGAGTAAAGACCCCAGAGATCACC
CCATCCTGCAGCCAAACTACCTGTCCACAGAGACGGATGT
GCTGGAGTTCAGAGAGTGTGTGAGGCTCACGCGGGAGATC
TTCGCTCAGCAAGCGTTTGATGAGTTCCGGGGCCCCGAGG
TCCAGCCGGGCCCTGCAGTGCAGTCAGACGCGGAGATCGA
CGCTTTCGTACGGCAGAAGGCAGACAGCGCCTATCACCCG
TCCTGCACCTGTAAGATGGGCCGGCCGGAGGACAGGATGG
CAGTGGTCAGTCCTGAGCTGCGGGTGTTTGGTGTGGAGGG
GCTACGGGTGGTGGACGCCTCCGTCATGCCCAGTATGGTC
AGCGGGAACCTGAACGCTCCCACTATCATGATCGCAGAGA
AAGCGGCGGACGCCATTAAAGGCCTTCCCTCACTGCACGA
CCCTGGAGTTCCTGTTTACCAGCCCAGAAAACACCCTTAA
CCTGATCCGCCATGGTAAAACCGTCTCCTAACTGCAAGTG
TTGTCAAAAGTATGGAGTTCAGTACCAATCGACACTGAAA
TTTGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations