ZFIN ID: ZDB-TSCRIPT-131113-1953
Transcript Name: chdh-201
Previous Name: chdh-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052627 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052627|OTTDARG00000036937|ZDB-GENE-120111-1 chdh|OTTDARP00000041365 chdh-001 LG_ CU638702.4 Danio rerio protein_coding NOVEL, 2006 bp
GGCTACAGAGGAATCCTTCTTCAACATCTCCATAGGTCAG
CTGTGCGGACACTACAGCACTGCACGGCTGCAGATGAGTA
TCAGTGCATTGCTCTGAAAGCTGACCGCTCTGACATCTCT
ATCATCTCCATCATCTTCATCATCTCCATACTCTCCATCA
GTATGGCGTGTTTCTCCTCCTCGACGAGGCTCATGTCCAG
CCTCTGCAGTCCACTGCTCCATCACAGGTACATCAGTACC
GTGGTAAACAAGAATACACCGTCCTACAGCTATGTGATAG
TCGGGGCCGGTTCTGCGGGCTGCGTTCTGGCCAGCCGGCT
GACGGAGAACCCATCCGATTCTGTGCTGCTTCTGGAAGCG
GGACCCAAAGACAAGCACCTGGGCAGCACACGTCTGTCCT
GGAAGATCCACATGCCGGCCGCGCTCACATACAACCTCTG
CGACGACAGGTACAACTGGTTCTACCACACGTTACCTCAG
GCCCACATGGATGACCGTGTGATGTACTGGCCCCGCGGGC
GTGTCTGGGGCGGCTCATCCTCACTTAACGCCATGGTGTA
CATCCGGGGACACGCAGAGGACTACAACCGCTGGCAGAGT
GAGGGTGCGGACGGCTGGAACTACGACCACTGCCTGCCGT
ACTTCCGTAAAGCACAGACACACGAGCTCGGACCTGACCG
GTACCGCGGAGGAGACGGACCACTGCACGTGAGCCGAGGG
AAAACACAAAACCCTCTGCACTATGCATTCATCCAGGCGG
GACAGCAGGCTGGATACCCCTACACCGAGGACATGAACGG
GTTCCAGCAGGAGGGGGTCGGCTGGATGGACATGACCATT
CATAAAGGTCAGCGGTGGAGCACAGCGAGTGCGTACCTGC
GGCCGGCGCTGTCCAGACCCAACCTGAGCACAGAGGTACG
CTGTATGGTGACGCGCGTGCTGTTCGACGGAGCCCGCGCT
CGAGGAGTCGAGTACCAGCAGAACGGACAGATCAAAAAGG
TGTTTGCAGAGAAGGAGGTGATTCTGAGCGGCGGCGCCAT
CAACTCTCCACAGCTCCTCCTGCTGTCTGGAGTGGGAAAC
GCAGATGAGCTGAAAACCCTGGACATTCCTGTGGTCCAGC
ATCTGCCCGGTGTGGGCTGTAATCTGCAGGATCATCTAGA
GCTGTATGTTCAGCATGCCTGTACTCAGCCCATCACTCTC
TACAGAGCCCAGAAACCCTTACAGATGCTCAAGATCGGCC
TCGAGTGGCTGCTCAAGTTCACAGGTTACGGAGCGACGGC
TCATCTGGAGAGCGGAGGCTTCATCCGCAGCCGGCCCGAT
GTTCCTCATCCCGATATTCAGTTCCACTTCCTGCCCTCGC
AGGTCATCGATCACGGACGCGTCAGCTCCAAGATCGAAGC
CTTCCAGGTTCATGTCGGGCCCATGAGGAGCACCAGTGTC
GGCTGGCTCAAACTCAAGAGTAAAGACCCCAGAGATCACC
CCATCCTGCAGCCAAACTACCTGTCCACAGAGACGGATGT
GCTGGAGTTCAGAGAGTGTGTGAGGCTCACGCGGGAGATC
TTCGCTCAGCAAGCGTTTGATGAGTTCCGGGGCCCCGAGG
TCCAGCCGGGCCCTGCAGTGCAGTCAGACGCGGAGATCGA
CGCTTTCGTACGGCAGAAGGCAGACAGCGCCTATCACCCG
TCCTGCACCTGTAAGATGGGCCGGCCGGAGGACAGGATGG
CAGTGGTCAGTCCTGAGCTGCGGGTGTTTGGTGTGGAGGG
GCTACGGGTGGTGGACGCCTCCGTCATGCCCAGTATGGTC
AGCGGGAACCTGAACGCTCCCACTATCATGATCGCAGAGA
AAGCGGCGGACGCCATTAAAGGCCTTCCCTCACTGCACGA
CCCTGGAGTTCCTGTTTACCAGCCCAGAAAACACCCTTAA
CCTGATCCGCCATGGTAAAACCGTCTCCTAACTGCAAGTG
TTGTCAAAAGTATGGAGTTCAGTACCAATCGACACTGAAA
TTTGAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
chdh-201 Contained in:
[Fosmid] CH1073-317D10 (1)

Genome Resources: Vega_Trans:OTTDART00000052627 (1),  Ensembl_Trans:ENSDART00000158789 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)