ZFIN ID: ZDB-TSCRIPT-131113-1901
Transcript Name: junbb-201
Previous Names: junbb-001, junbl-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051846 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051846|OTTDARG00000036415|ZDB-GENE-040426-2666 junbb|OTTDARP00000040738 junbl-001 LG_ CU695216.16 Danio rerio protein_coding KNOWN, 1405 bp
AATCAAGCCAACATCTCTCTGAGGGAGCGTTCACTTTCAG
TAGGAGACTCAGAAACATCCCGAGCGGTTCACCGCTGCGC
TACTCGGCTCATTCTGAAGGACTTTGGCTTGTGTTTAATT
CATTCCAGAGGAGCATCGGCAGATTGTTAGATTCCTGAAG
AGGGGAACGGGACAGAAAACGCCGCTTCATTGACTGTCAT
CGTTATTCGCGCTCCTTCTCGGACGGTTTTACAGGTGGAC
GCTGAACTGTCAGGCTCGCCAGCTGAACCACCGGTTTTCA
AACTCTATGAGTACAAAAATGGAGCAGCCGTTTTACCACG
ACGACTCGTTTCTGTTGGGTTACGGTCACAACGACGCGGC
TCTACACGACTACAAACTCCAGAAACCGGGCATGAACTTG
AACGTGACCGAGCCGCCCTATCGGAGCCTCAAATCGGACC
TCTATCAGGCGTCCAGCGCCGATGTGGGCTCACTCAAACT
GGCCTCCCCGGAGCTGGAGAGGCTCATCATCCAGACGGGC
AACGGCGTGCTGACGACCCCCACACCGGGCCAGTACCTCT
ACGGTCGGGGGATCACCGACGAGCAGGAGGGCTTCGCGGA
GGGCTTCGTCAAGGCTCTGGATGAGCTCCACAAGATGAAC
CAGATGCCCCCGCCCAACGTGTCGATTGGAGCCGGCGGCG
TGACGACGTGCTCGACAACTGCGTCCGTTTTCGGCTCCTC
CCTGCAGTCGGAGCCTCCCATTTACACGACGCTGAACGCA
TACTGCCCAGCACCCAGCCACCCGTCCACCACCATCAGCT
ACCTGCCGTCCCACATACAGCAGAGCCAGCACCCGGAAAC
CGCGCACGCGTTCCAGCACCCCGGCGTGCTCCCTCAGCGC
TTCTTGCCTTTGAAAGAGGAACCGCAGACTGTTCCCGACA
TGCATAGCAGCGACGGCTCGCCGCCCATGTCCCCGATCGA
CATGGACTCGCAGGAACGCATCAAGGCGGAACGCAAGAGG
CTCCGGAACCGACTGGCGGCCACCAAATGCCGAAGGCGCA
AACTAGAACGCATCGCGCGGCTGGAGGAAAAAGTGAAGGT
ACTGAAGTCCGACAACGCCGGACTGTCCAACACAGCGTCT
GTTCTGCGGGAACAGGTGGCGCAACTCAAGCAGAAGGTCC
TGAGGCACATGAACAGCGGCTGTCAGCTCATGCTGACCAG
TAAGATGGAGGCGTTTTAAACGCGACGGGACTTTCACTAA
AGCAAGACGCAGAAATAACACTGGAGATTGTTTGTTCGAC
AACTGAACGACACTCGCGAGCTCTCAGCTGAGCTGTTTTG
GACCCGTCCTGGACTCCGATTAAAAGCTCGTCGCGAAGCG
TCCTCTGGGACGGAAGAGAACGGACACTGCGGCCCCCAGA
GAGAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
junbb-201 Contained in:
[BAC] CH73-348N11 (1)

Genome Resources: Vega_Trans:OTTDART00000051846 (1),  Ensembl_Trans:ENSDART00000170917 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC053154 (1) 1708 nt
GenBank:EH491446 (1) 1010 nt
GenBank:EH496512 (1) 1010 nt
CITATIONS (2)