Transcript

otop2-202

ID
ZDB-TSCRIPT-131113-187
Name
otop2-202
Previous Names
  • otop2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049783 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049783|OTTDARG00000035034|ZDB-GENE-050104-2 otop2|OTTDARP00000039056 otop2-001 LG_ CU928004.8 Danio rerio protein_coding KNOWN, 2027 bp
ATGTCGACAAAGGCAGATCTAGAAGCTATGGAGAACCAGA
TATCCACCATCCAAATCAGCTCCCATGGAGAGACGCCTAA
CCGGGGGTTCAAGCCTGTGGAGAAGGGCCGCAATTGGGGA
TGGCTCCTGTCTGGGTTCATCTCCTTAAACGCTCTGCTTT
TGGGAATCGCCATCGTGAGTGGAAGTGTCTTCAACAAGGT
CCAGATCACTTCCTCTCACCTTTTGATCTTCCTCATCTTG
CTGGTCATCCTGTCCACTGTGTGGATGCTTTACTATAAAG
TGCACACTTCCCGGGTGTACCGCGCAGTGCTCTACAAGGA
CAGTCATGCCGGACCTGTTTGGCTGAGAACTGGACTGGTT
TTGTTTGGGATCTGCAGTGTAATCATGGACATCTTCAAGA
TTATTTTTTACGTGGGTCGAATGAACTGCGAATCGCCTGT
CAAAATAGCCTTCCCCGTTGTGCAAGCGGTGTTTGTCATC
GTCCAGACATACGTGCTCTGGATTCATGCTAAAGACTGTG
TGCAAATCAAGCAAAACATCACACGTTGCGGCCTGATGTT
GACTCTGTCCACCAACCTCATGGTGTGGATGATGGCTGTG
ACTGAGGAGTCGCTCCACCAGACTGTGGCTCCAGTCAAAC
CTCCGACCAACAACAACAGCTACAACGACACACTTGATGG
TCGTGCTGCAGCCAGTGAATGTGAGTGTCTCCATAACATG
TGCGACCTCTTTGAGAAGGCCTACTACTACCTGTACCCCT
TCAACATCGAGTACAGCCTCTTCGCCTCCGCCATGACCTA
CGTGATGTGGAAGAACGTCGGCCGCAAGATGGACGACCAC
CACAGCCACAAGCTGCACTTCAGCCTGTGGGACGTCCTGG
TGGGTCCGCTGGCGGGCCTGATCGTCCTGGTGGCGGGTCT
GGCTACGTTTGTGGTGTACGAAGTGGACGTGTCTAAAGAC
GACCCTAAGAAGAAGGAGGAGGCTCTGATAATGCACTACA
TCATGAACATAGTGGCCGTCCTGCTCATGTCCAGCTCCGC
TCTCGCCGGATGCATCCTCTTCCGCATGGACAAGCGAGAG
CAGGTGTCGGGGAAGAACCCAACGCGGAGTCTGGATGTGG
GACTCCTGGTGGGAGCGTCATTGGGACAGTTCCTCATCTG
CTACTTCACTATAGTCGCTGTTTTGGCGTCTGGCGTCCAA
GGCCACACGAATGGGCTCAACCTAGCATGTGCTATGCTAA
CGGTGATCGAGCTGTGCATTCAGAATGCCTTCCTCATCAA
GGGCCTCCATCGGGAGCCCTTTAAGGAGACTGAGGTGGCC
ACCGTCTTCGCCAACGTCATGGCTGTGAAGGAGCGAGACC
CAGAGAGACGGAGCAGCTCCATCGTGCCCGCACACACACT
CCCCATCCCGCTGACTCTACTGCAGGGCCGGATGTCCTGG
AAGAGGAGGGTCCTGAAGGAGATCTGCGCCTTTCTGTTGC
TCTGCAATGTCACGCTCTGGATAATTCCAGCCTTCGGAGC
GCGGCCTCAGTTCGACAACACCGTTGGGCCAGACGTTTAT
GAGTTCCAAACGTGGGCCGCCGTGGTAAACATCGGAATGC
CATTTGGGATCTTCTACCGAATGCACTCGGTGGCGAGTCT
GTTTGAGGTGTGCCTCGCTGCCTAAAGCAGACCACCATCC
CAGAACTGTACCACCCCAATGCACATATCTATGTAAAATA
ATATATTTTTATAGACTATTTTTGTTTAGCCAAATTGCTT
TTGAGCTAATTTGGCTTGCCGTATGAGTGCGTGAGAGAGT
GTAGATGTAGACCATGTTGAACTGAAATCTTTCTGAATGT
GTGAATATCGATATCTACTGAATTATGGCCTAGCCCTGTT
ACAGGCGTTCAGCTGTTAGCAATGCAGCATAAAACCCTCC
AGAAAAAAAGCGATGCTGTCAAAGATGTCTGTTTGTCGTG
TCTGAAAAGTGCGAACACTGCTGTACCCTTTCTGTTGCTG
ATGGATAAATGAAACGTGGAATAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations