ZFIN ID: ZDB-TSCRIPT-131113-179
Transcript Name: csf2rb-202
Previous Name: csf2rb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049698 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049698|OTTDARG00000034980|ZDB-GENE-080115-1 csf2rb|OTTDARP00000038986 csf2rb-001 LG_ CR812472.9 Danio rerio protein_coding KNOWN, 2322 bp
TGAATTGGACTTTTAGAGACCAAAATACACTTATCTCAAT
ACGGATTACAGGAATGTTTAGGAATCTGTGTCTGATGAGG
AAAACACAGTGCTTGTACACATAAAGACCATCAAGGTGTG
TCATGGAGAAAACACAGTTGTGACAGTAGGAACAGCGTGT
GAGGAGTCTTGGAAGTAACAAGAAGGATCACCAGCCTTAA
AAAGCTTCTCTAATCTTGCATCCCAGCTACAATGTTCTCC
ACATGGTTTCTGCAAATGTTTGTATTCGCTCTGCTGGTAA
GAGGGAACACCGGAAATAACCAGTGTACTCATCATGAAGT
CGAGCCTGGAAAAGACTCTGCAGTGATGGATTCTTTGCTG
TGCTACAATGACTACAAATCCTATACAGAATGTACATGGG
AGACTGATCCACGTGCTAACTTCACTTTGTATTACTATGA
CAAATATAAGAAAGCAGAAACACTTTGCCTCTTGAATAAA
CCCCATGTAGTTTTACCCAATGGGAAGTTTTCTCACGTGT
GTCGCTATAACACAGGGAGATTTTCACTTAACACCAATCA
CACCCTATACTTCAAAGTACAATGTGGAAATACTCCCACA
TCTCTCCGAGTTGCTCAGCATGTGGAAAAGTCCTTTACTG
TCATGTGCATGATTTCAGGGAAAGTTAGAGCCCCGGTCAG
CTTGACGGAGATGATGACTGATGGAGGAGGTCGCCTGCTG
TCCTGGAAAAGTCCGTATCCTGCATCCTCAAATATCACAA
GGTCTCTCATGTACCAGCTTCAATATCGCAGACACATGCA
TGACTGGACTACTGTGGATAAAATAAATGTGTCTGAACAC
ACGATCATCAAGGAATCACTGTTTCCGGGTTATCATTATG
AAGCCAGAGTGAGGGCAAGGGGTCCTGTAGGACTCTGGAG
CAACTGGAGTCCCCTGGTGTCCTGGAAGACTCACAATGAC
GTCAACAAAGCTCTTAACCTGCAGTGTGTGATAGAAGGAG
AAACAACAGTAATGTGTACCTGGCAAATGAGAACAGAGTA
TTTTCAGTTTATGACTTATCATATGTTGTGCCATGATAAT
ACTGGAGACCGTCTTTGTTGTAAAACCCCCCAGCTGAAGT
CCAGCAACGATGAGCTCATTGAGTTCATGTGTTCTGTCAA
TGTCATCGACCCTAACCAGTTAACAGTGGAGCTAAAACCA
GTGCTATTCACACGGACTTTTAAAACTGCACACCACATTA
AACTCCCTCAACCTGACAAGTTAAACACAACGGAAGTGGA
TGATGCTTTACAACTGAACTGGTCAACACCTGCTGTTAGA
GGAGGAATTGAATTCACGGCTGAGATAAAACTCTCAACCA
ATAAGCAGTCGATGATCTTTAACTGTACTGAGAGGGTCAA
TACATATAGGATTCCCTTCAAATTTCTACATCCTTCAACT
GATTACCTGGCCCAGATCAGATTTGTGCCTATTCCTAAAA
AAAACTACAGAGTTCAGCCATCAGACTGGTCAGAGCCAGC
AAATTGCACCACTAAGCCAGCTTCGTCACCCATCAATCAT
CTCATCCAACCGTCATCCAACATTCCACTAACCTACATTT
TGGCTGGTGTGCTTGTACCAGTGTTAATCGGCATCCTATA
CAGTGCTCTTCCAGCATGCCACAGAAGGATTAACAGAAAG
ATCGTCTTATGGAAGGGATCGATTCCATCACCCATAAAGA
GCAAAGTACTCGAGGGGGTGATCAAGAAATATCCAGCCGG
GTGGCCGTATCTTCAGAGTGAAAAAGAGACAACCTCTGTT
TGTGTACTGCTGGCTACTGACAATATCAGTGTCTGCAATA
ACGTCTCCTGGGATTCACCCAAGTTACAGGTTGAAGATGC
TGTAAAAATGGAACAAGCAGGTGGATCAAACCAATTGAGT
GCCTCATTGGGGGAGGACATGTGCAAGGACAAATCAGGTT
TGAGTTTCAGCGGACCTTACATTCTGTGCTGTGAAGATTC
TTGCATCCACGACAAAACATCGGTCGAGTCCCAAGACACA
GTCCAGACAAGTGCTTCTGAAAAGTTGGAGATTTTTACAA
TAAAAGGAGGATATGTTGTAAATTCTCCGACTGACATGCC
AGCAACTCAAAATCCCACCCCCATTGACAGCCCAACCAAT
GAGCCATCAGCTGAACCCCCTGCGTACACGCCCAGCCCAG
ATCCAAGCTGTACAGTCATCGCTCATCCATCGGGATACTT
CATGATGCCATGCGTTTCCACTGAGCAATTAGAGCCGAAA
GGATACGTGACACTCGAACATAATGAATGTGATAATGAGT
GA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
csf2rb-202 Contained in:
OTHER csf2rb-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049698 (1)
  • Ensembl_Trans:ENSDART00000153553 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT061081 (1) 830bp
    CITATIONS (2)