header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1724
Transcript Name: kcnn4-202
Previous Names: kcnn4-001, dkeyp-84f3.3-001, si:dkeyp-84f3.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048583 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048583|OTTDARG00000034349|ZDB-GENE-131127-192 kcnn4|OTTDARP00000038110 DKEYP-84F3.3-001 LG_ BX005256.11 Danio rerio protein_coding PUTATIVE, 1608 bp
AGGCGGAAGGACAGGACGGGGAACAAGGCGACTGAAGGCG
ACTGTGTGAACTGAAAACACAAGCGCGCTATGGAGATGAC
CGCTCGCTTCGCGCAGTTGGAGACCATGGTGGACGGCAAA
AACTGCGATGGCCTTGTGAACCATAACGGGGAAACAACAG
AGATAAGAGTTCCGCTGTCCCACATGGGGAAGAGAATGAG
TCCTATTGAAGGGTTGAACCTCTACAGACTGCGCGACAGA
AAGTTCTTACTGGAGGACAAAAGGCGCCTGTGCGCGTGGG
CTCTGGGCACCGCGCTGTTGGGCATTCTGCTAATGGTGTT
ACACGCTGAGCTGTGCCCAGTAGTGTACCAGCCGGGATCC
ATATATGCCCTCTCCATAAACGGTCTCATTAGTTTCTCCA
CTGGTTGTCTGCTCATTCTCATCATCGCCTTCCATTATAA
AGACATCAGACTTTTCATCATTGACCACAACCAGGTGGAC
TGGCGCATTGCCATGACCAGCTACCGGGTGCTTGGCATCT
CCCTGGAGCTCATGGTCTGCGCCATCCATCCCGTGGTCAT
CTACCTGAGGCCAGACGGGGAGGACAAACTTGGGAGGAAA
CCAGAGCAGAATTCGTCAACCCCCCTGTGCTTGTCATCCA
GTCACAGAGAAGTCATGCTGGACGTTGAGCTGCTGCTGTC
GGCCCTCATGTTCTTGAGACTGTATCTGGTGCACAGAGCC
GTCCTGTTGCACAGTAAAGTGCTCCTCAGCGCCTCGTACA
GGAGCATCGGATCCCTCAACAACATCAACTTCACCTTCCG
CTTCGTGCTAAAGGTGTTAATGAACAAATATCCAGCCCGA
ACGCTGCTGGTCTTCATTATGTTCTTCTGGCTCTCTGCAT
CTTGGATGCTGCGACTGTGTGAAAGGGAGAAGCAGGTAGA
CACAGGTGGCATGGACACAGCGCTGTGGCTCATTGCCATC
ACCTTCCTCACAGTGGGCTATGGAGACGTGTCCCCTCACA
CCAGCTGTGGAAAGGTGGTGTGTCTCTTCACAGGCGTCAT
GGGTGTGGCTTGTACTGCTATGTTGGTAGCAGTCATGACT
AAGAAATTGGCACTTAACAAAGGAGAGAAACATGTGCATT
TCTTCATGATGGACATTCAGATCTCAAAGCGGATCAGACA
TGCAGCAGCCAATGTGCTGAGGGAATGTTGGCTTCTGCAT
CGCACTACCCAAACTAAATACACTAGTGGAGAACATCGAC
ACCATCAGAGGTGCCTGCTGGAGGCCATCCGTGTATTTCG
TCATTTGCGGTTGAAGCAGAGGAAGTTAAGAGACTATGCC
AGTGAAATGGTGGATCTCTCAAAGATGCAGATGATCATGT
GTGATCTGAGTGCAAACTGGAACAGCTCTTATCACGAGCT
GGAGCAGCGAATCATCTCCATGGAGCAGAAGCTGGATGAA
CTGAGACGCTCCTTCCAAAACACCTCGGAGCTGCTCACAC
AGGCGCTACATCACCGCAGACTGGACTACAGGTGACCTGT
GGCATCTCTTTGGAAGGCTTACAGTCTTCATCCGCTGAGC
ACTCTACAGTCAAGCCACTTGAACTGATGGAAGATCTTTA
TGACATTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kcnn4-202 Contained in:
OTHER kcnn4-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048583 (1)
  • Ensembl_Trans:ENSDART00000154269 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB884647 (1) 546bp
    GenBank:EV561278 (1) 497bp
    GenBank:EX152978 (1) 461bp
    CITATIONS (2)