ZFIN ID: ZDB-TSCRIPT-131113-1723
Transcript Name: negaly6-201
Previous Names: dkey-79d12.2-001, negaly6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048580 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048580|OTTDARG00000034346|ZDB-GENE-131121-604 negaly6|OTTDARP00000038107 DKEY-79D12.2-001 LG_ BX005256.11 Danio rerio protein_coding PUTATIVE, 826 bp
ACTCTGAGCTCAAATCACAATGGCATGGTCTGTCCTCTTT
ATTTTTACCTGCACACTTTTCTACAAAGTAAGTTCTCTAA
CCTGCTATCAGTGCATACCTGAGACCTCCATTAAATGTAC
TGAAACTACAGTGGATTGTCCTGTCGGTCAGTGTGGGACC
ATGAAAACCACATCTTATTTGGGAAACAATGCAATTTCTG
ATATGATTATGAAGAACTGCTCTGCAACTCAAGAATGTGT
GACTGCATCTGTAAACTTTGGAGTCACAAAGATCATCATC
AACAATGAATGCTGTAACACTGACCTGTGCAATAAACAGA
TCAAACAAGAATCCCAAAATAGAATCCCAAATGGAATGCA
CTGCTACACTTGCAAAGGAGAAGACTGTTTATCAACTTTA
CCTTGTGCTGACGGAGAAGATCATTGTGTGAAAGCAACAG
TCATTTCAGAGGGACAGATGATGACAATGAGAGGATGTGC
AACCAGAAGCTTTTGCAGAGGTGACCTGTCCTCCCAGATC
AGCCAAAACAACACAGCGGCAGTGGGTCTGACCTGCTGTA
AGGGGCATTTGTGTAACAGCTCAAAAACCCTCATTCAGAG
CCACATGGTTCAGCTGAGCTTTCTGATGTGTGCCATTATA
CACATGCTGTTGTAAGGTTATATAATATGGTGATGTTGAT
CGTCTTTTCACTGACACAATTTAAAACAAATTAATATCGA
ACCAACATTACTACACTATTAAAAATTCTGGGTTGTTGTA
ACCCAATGTTGAGTGAGATATGGACAAACCCAACAATGTT
ATGGGTTACATGACAACACAATTTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
negaly6-201 Contained in:
[BAC] DKEY-79D12 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048580 (1),  Ensembl_Trans:ENSDART00000131167 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO924904 (1) 839 nt
GenBank:EB862820 (1) 411 nt
CITATIONS (2)