ZFIN ID: ZDB-TSCRIPT-131113-1723
Transcript Name: negaly6-201
Previous Names: dkey-79d12.2-001, negaly6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048580 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048580|OTTDARG00000034346|ZDB-GENE-131121-604 negaly6|OTTDARP00000038107 DKEY-79D12.2-001 LG_ BX005256.11 Danio rerio protein_coding PUTATIVE, 826 bp
ACTCTGAGCTCAAATCACAATGGCATGGTCTGTCCTCTTT
ATTTTTACCTGCACACTTTTCTACAAAGTAAGTTCTCTAA
CCTGCTATCAGTGCATACCTGAGACCTCCATTAAATGTAC
TGAAACTACAGTGGATTGTCCTGTCGGTCAGTGTGGGACC
ATGAAAACCACATCTTATTTGGGAAACAATGCAATTTCTG
ATATGATTATGAAGAACTGCTCTGCAACTCAAGAATGTGT
GACTGCATCTGTAAACTTTGGAGTCACAAAGATCATCATC
AACAATGAATGCTGTAACACTGACCTGTGCAATAAACAGA
TCAAACAAGAATCCCAAAATAGAATCCCAAATGGAATGCA
CTGCTACACTTGCAAAGGAGAAGACTGTTTATCAACTTTA
CCTTGTGCTGACGGAGAAGATCATTGTGTGAAAGCAACAG
TCATTTCAGAGGGACAGATGATGACAATGAGAGGATGTGC
AACCAGAAGCTTTTGCAGAGGTGACCTGTCCTCCCAGATC
AGCCAAAACAACACAGCGGCAGTGGGTCTGACCTGCTGTA
AGGGGCATTTGTGTAACAGCTCAAAAACCCTCATTCAGAG
CCACATGGTTCAGCTGAGCTTTCTGATGTGTGCCATTATA
CACATGCTGTTGTAAGGTTATATAATATGGTGATGTTGAT
CGTCTTTTCACTGACACAATTTAAAACAAATTAATATCGA
ACCAACATTACTACACTATTAAAAATTCTGGGTTGTTGTA
ACCCAATGTTGAGTGAGATATGGACAAACCCAACAATGTT
ATGGGTTACATGACAACACAATTTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
negaly6-201 Contained in:
OTHER negaly6-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048580 (1)
  • Ensembl_Trans:ENSDART00000131167 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO924904 (1) 839bp
    GenBank:EB862820 (1) 411bp
    CITATIONS (2)