Transcript

si:zfos-1192g2.3-003

ID
ZDB-TSCRIPT-131113-1686
Name
si:zfos-1192g2.3-003
Previous Names
  • zfos-1192g2.3-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047713 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047713|OTTDARG00000033852|ZDB-GENE-030131-4956 si:zfos-1192g2.3|no_translation ZFOS-1192G2.3-003 LG_ CU861504.6 Danio rerio protein_coding NOVEL, 860 bp
CTTATTACAGATTCTCATCAGTGTAACAGGCAAACAGACA
TTCACTCTGATTCACTTCAAATTGCAGGAGCCACTTTCAC
ATTCACTCCAATTCACAAGAATGTAACAGATGAAACTGTA
TCCACACTCAATCCAGATTTACACACACTCCAGTTCACTT
CTGATTCACATCAAGGCAACAAAGGCAAAACTGTATTCAC
ACTCATTCCAGATTCACACCAATATAACAGGCAAAACCAC
ATTTGCATTCACATCAAATTACAGAAGCTGCATTCACATT
CACTCCAATTCACAGCAGTGTAACAGGCGAAATCGCATTC
ACACTTACTCTGATTACCTTCAAATCAAACAAACTGCATT
CACTTTCTCTGCTTCATTTCAGATGCAAAACCACATTCAC
ACTCGCTCTGATTCCAGAAACCACATTCACACTCGCTCCG
ATTCCAGAAACCACATTCACATTCCAGTTCACTTCAGATT
CACACCAATGTAACAGACAAATGTCATTAGGATGTTGTGT
GTAAACCGGACTGAGGTGTAATGGAGTGTGTGAATGATTG
GTTTGATTTCACTCTGTCCATTTGCAGTTCAAGACTCTGC
GTAAGGATGAGGAGCGACATGTTCGTCTGGAGGGAAGCGA
CTGTGATGACTGGAAGTGCATCGACTTCGGCTCAGTGGTG
GTTCACCTGATGCTGCGGGACTGCAGAGATCAGTTTGAGC
TGGAGAAGCTGTGGACGCTGCGCTCCTGTGATGAACAGCT
GAGCCGCATCCCTGCTGAAACCCTGCCTGAAGACTTCATC
TACCACAACACACAACACACACCATCAGCCAGCTCAAATA
AACACACTGACTGACTTCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations