Transcript

sv2bb-201

ID
ZDB-TSCRIPT-131113-1662
Name
sv2bb-201
Previous Names
  • sv2bb-001
  • dkey-52p2.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046874 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046874|OTTDARG00000033342|ZDB-GENE-030131-2789 sv2bb|OTTDARP00000036905 DKEY-52P2.1-001 LG_ CR854891.10 Danio rerio protein_coding NOVEL, 2751 bp
GCATCCTAATCTTCCTGTTCAGCATCTCTGTGGCTGTCTG
GATGATCCCTCTCTCTCTTCTCCATGTTTAAACTCAGGCC
GGATACTCCGTCTTTTTGGGAGACTTTACTTTTTTCTTAA
ACAGAGGGACTAATTTGATGCCAAGTCAGCATAATTTCGA
CGGCTCAGCATGTGGCCCATTGAGAGCGCCAAAAATCAAA
GGTGATTAAAAGTGTCCAACAGCCATCCTTACAGCCACAC
TCAAGAGACCCATTGCTGACTGGAGGTTCTTCAGCTTGAT
TTCTTTAGCAGTAAACACGCAAGCAGATCAAACACGTACC
AAAGCAGCTACGGATTATGCACATATAGGCTCCGACTTGA
AATTTAGCTAAGAACATCTCTGAAACCATGGCGGACCCAT
ACCAAAACAACATTTACCACCAGGGAGATGGAGACAGTTA
TGGGACGTATGGACAGGGAGGACAGGACGGCTACGGGTAT
CAAACCGACTACCCTCCCCAAGAAGAAGACGCTGCCAGTG
ATGCTACTGAAGGACACGATGAAGATGATCAAATGTATGA
AGGGGAATATCAGGGTATCCCACATCCAGATGAGGTCAAG
GCTGCTCGGAGGGCGGCGAGAGCGAAAGCAAGGACCCCGA
CGGACACCGTGTCGGAACTCGAGGAGCTTGCCGAACAATA
CGAGGACATCATGGAGGACTGTGGACATGGGAAGTTCCAG
TGGACCCTGTTTGTGGTGTTGGGTCTGGCGCTCATGGCAG
ACAGTGTCGAGTGCTTTGTAGTGGCTTTGGTTCTACCCAG
TGCTGAGAAAGACATGTGTTTGTCCCACGCTGAGAAGGGA
ATGCTGGGTTTGATAGTGTTTCTGGGAATGATGTTCGGAG
CGTTTATTTGGGGTGGTCTGGCTGATAAAGTAGGTCGACG
GAAATGTCTGATCATCGTCTTGGCCATGAACTGCATCTCT
GCCTTCTTCTCCTCGTTCGCCCAGGGATACGGTTTCTTCC
TCTTCTTCAGGCTGTTTTCTGGAATAGGGATCGGTGGCTC
CGTCCCAATCGTGTACTCGTACTTCTCGGAATTCCTGCAA
ATGGATAAGAGAGGAGAACATCTCAGCTGGCTCTGCATGT
TTTGGATGATGGGTGGCATCTACGCCTCCTTCACTGCATG
GGGCATCATTCCACGATACGGCTGGGGTTTCAGTATGGGC
ACAGAGTTCCAGTTCCACAGCTGGCGGGTGTTTGTGCTGG
TTTGTGCTCTCCCAGCTATAGCAGCTTTTGTTGGACTAAT
GTTCATGCCTGAGAGCCCACGCTTCCTGCTAGAGAATGCT
AAACATGATGAAGCCTGGATGATCCTTAAACAGGTTCATG
ATACCAACTGGAGAGCCAAAGGACAACCAGAAAAAGTCTT
TACTGTAACTCAAATCAGGACTCCAAAGACCCAAGAGGAT
GAGTTCATTGAGATTCAGACTGCAACTGGAACTGCTTTCC
AAAGATGGGTGGTTCGAACTTTAACACTGACCAAGCTGGT
CATCAAAAATGTTTTGTCTCTCTTTGGTCGTGAGCTAAGA
CTCGCTACTCTACTGATGGCCATCATATGGTTCACTATGG
CATTTAGCTACTATGGGCTTTCGGTATGGTTTCCTGACAT
GATCAAACACCTCCAGCATGAGGAATATGAATCCAAAGTG
AAAGTGTTCCATCGGGAAAAGGTGGAGCAGTTTCATTTCA
ACTTCTCTTTGGAAAACCAAGTACATAAAGAAGGGGAATA
CATCAACGACAAGTTCATCAACATTGAGATGAAGTCTGTG
AAATTTGAAGACTCCTTATTTGTTGATTGCTTCTTTGAAA
ACGTCCGATCAACGGAAACGATGTTTGAAAACTGCACCAT
CCGCAGTACTGTTTTTTACGACACAGACTTGTATGAAGAA
AAGTTCATTGACTGTACTATGGAGAACGTCACTTTCCTCC
ACAACAAGAAGGGATGCCATTTAGACTACGAGGAGGACAA
CGACGTCCTCATCTACTTGGTCAGCTTCTTGGGCAGCTTA
GCCGTGTTGCCTGGAAATATTATTTCGGCACTCTTCATGG
ATAAGATTGGACGAATCAAGATTATAGGTGGTTCGATGCT
TGTTTCTGCGGGATGCACCTTTTTTCTGTTCTTGAGCTTC
AGTCAAGCCGCCATCATTGCCTGGCAGTGTCTATTTTATG
GTGTTAGCGTAGCAGCCTGGAATGGCATTCAGGTCATCAC
TGTGGAACTCTACCCAGCTTCTAAAAGAGCCACAGCGTTC
GGATTCTTAAACGCCATGTGTAAGCTGGCGGCCATTCTGG
GAAGCTCAATCTTCGCCTCATTCATAGGCATTACCAAAGT
CATCCCCATTCTGCTGTCATTCGCTGCTCTGGTCAGTGGC
GGAGTGCTGGCCCTGAAACTGCCCGAGACCAGAGAGAAGG
TCTTAATGTGAAAATCTGAAGCTCAAAGTGTATGACTATT
AGTGTGAAGATAACAACTGCTGGCATGAGTAAAATTGGGT
GTGTTGAAAAAAAAGACTAAATTACTAACAATATCCCAAG
GACCAAATGATGGCTCTACCCCTAGTCAACTATGTATCCA
TATGCCTGATATTTCATATACATGCCTATTCGGGGACACA
AAAAAACATCTGGACCACTTACATACAGTTGAAGACAAAA
ATATTAGCCCTTCTGTGAATTTCTTTCCTTTTTCAAATAG
TTATCAAATGATGTTTAACAGAGCAAGGAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations