header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1625
Transcript Name: setd3-201
Previous Name: setd3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032887 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032887|OTTDARG00000025039|ZDB-GENE-030131-9137 setd3|OTTDARP00000026599 setd3-001 LG_ BX088719.6 Danio rerio protein_coding KNOWN, 3816 bp
AAGTTAGGCTGTACCAGCAGACCGACCAGAAGAGGATTGA
ATTCCAGGTTGACAGGAGGATCCCTGCAGTCAATTGGAAG
CCATCCTCTCTCCCAAACCAGCAAGATGGGCAAAAAGAGC
AGAGTGAAGACCCAGAAATCGGGCACCGGAGCCACCGCTG
CGGTTTCTCCAAAAGAAATGATGAATTTAATCTCTGAACT
GCTGCAGAAGTGTAGCAGTGCTGCTCCTTCTCCCGGGAAA
GAGTGGGAGGAATATGTTCAGATTCGAGCTCTGGTGGAGA
AGATACGCAAGAAGCAGAAAGGGATGTCTGTATCGTTTGA
GGGAATCAGGGAAGACTTTTTCTCCGAGCTGATGGCCTGG
GCTGCGGAATGCAGAGCGTCTTGTGATGGTTTTGAAATAT
CTAACTTTGCTGACGAAGGATATGGTCTGAAGGCCACCAA
AGATATCAAGGCTGAGGAGCTGTTTCTGTGGATCCCTAGA
AAAATGCTTATGACTGTGGAATCTGCCAAGAACTCTGTCC
TCGGGCCACTGTACAGCCAGGACCGGATCCTCCAGGCTAT
GGGAAATGTGACTCTGGCTCTACATTTGTTATGTGAACGG
GCCAATCCCAGCTCACCCTGGCTGCCCTACATCAAGACCC
TGCCTTCTGAGTACGACACACCCCTGTATTTTGAAGAGGA
GGAAGTACGCCACCTGCTGGCCACACAAGCTATACAGGAT
GTGCTCAGTCAATACAAAAACACAGCGCGGCAATACGCCT
ACTTCTATAAAGTCATTCATACTCATCCGAACGCCAGCAA
ACTGCCCTTGAAGGATGCTTTTACCTTTGACGACTACAGG
TGGGCAGTGTCCTCTGTGATGACCCGTCAGAACCAGATAC
CCACAGCAGACGGTAGTCGTGTCACACTGGCCCTCATCCC
TCTCTGGGACATGTGCAACCACACCAATGGCCTGATCACA
ACTGGCTACAATCTAGAAGATGACCGATGTGAATGCGTTG
CTCTTAAAGATTACAAAGAGGGCGAACAGATTTACATATT
CTACGGTACAAGATCCAATGCAGAGTTTGTGATCCACAAT
GGTTTCTTTTTTGAGGACAACGCACATGACCGTGTGAAGA
TTAAGCTGGGCGTAAGCAAGAGTGAGCGTCTGTATGCCAT
GAAGGCTGAGGTTCTGGCACGTGCAGGAATTCCTGCGTCC
AGTATCTTTGCCCTGCATTGCAGCGAACCTCCCATATCTG
CTCAACTTCTGGCCTTCCTGCGAGTCTTCTGCATGACTGA
AGAGGAACTCAGGGACTACCTGGTGGGCGATCACGCCATC
AACAAGATCTTCACCCTGGGCAACACCGAGTTCCCTGTCA
GCTGGGAGAACGAAATCAAGCTGTGGACGTTCCTGGAAAC
ACGCGCTGCGCTGCTGCTGAAAACCTACAAGACGGCCTCA
GAGGAGGATCGCTCTATGCTGGAGAAACCTGACCTGTCAC
TGCACTCCCGCATCGCTATAAAGCTACGACTAGCAGAAAA
AGAGATTCTGGAGCATGCTGTGTCCTGCGGTCGGGCCAAA
CGCCTGCACTTCCAGAAGCAGCTGGACGAAGGAGCGCCGC
TTCCACTGTATGAAGAAAGCGACATCGCCCTTTTGGAGAA
CGCAGACGCCAAACTCCCCATCATCCTGCGTAAACTGGAA
GAAGAAGAAGAGGAGCATGTTGAGGAGATGAACCAACTCA
CGCCTGACGCCGTCTGCATGAACTCCTCCAAAATCCCTGT
CCTGAACGGGCAGTGTAAAGATGTCAACGGTACACAAGAG
GATCCTCCAGGAGGCGGCACAGTGGTAAAGGAGATTGAGA
AGCATGACCCAAGTGCCAAACGAACTGAAGGTGAACCAAA
AGATGCTGACAAATAGTCCTGATCAGAGCTCGCTGGCGAT
ATTAGTTCCTGCTATTTATTTATTTTGGTTTAAGAGACTG
ACAAGTAGGAGCAAACGCTTTCTAGACTAAAAAAAAAGGA
TTTCAGTTTAATTATGTTTTGTTTTTTTATTAAATGCAGC
TTAAGTGTGAGCTAGCTTAAGTTAAAAGGAGCCTGTTGTT
TTATTTTTGTTGTTTTGTTTGAGTTTTTAATCAGTGCCAC
ATTTGGTTTCTTTTGTAGTAGCTTTGCTCGTGTTGCCAGA
CAGCTAGTTGAAGAAGTAACCAATCATATGGACTAGATGA
AGGCTTGCTTGGACTTCACAAAATGAGAAAAATGTATATC
GAAGACTTTAACATGGTAATGTTGCCAAGGATGTTTCTGC
TTAGTCATCCAAAACGCTGACTTGGGGAATTTTCCTACAG
CATTTGCTGTAGATCATGCCAGAAACACGCTTGACGTTTA
GTGCCGCTTGACAATCATTACTCTTAAGTTCTGTCATCGA
TCTGTGGAGAGATCGTCACTGCCTCGCTGCACGCTAGCTA
CTTTCCCTGCATAAAAAGTAAGCTTACCGAAAAGGTTATA
TTTTCGTGCACTTCAGAGAACAGTCATTCTCAAAGTGAGC
ATTAGTTAGTTGCAACCTGAACTAGAGGATAAGAAGTTGT
TAATGGCCGTATGGTTATTACTTGCTGTGAATGTACTTCA
AAGTTTGTGTGTTAAAACCCTTCACTTTTGAGTATGTTTT
TATTAGGTGTTCACAAGACCGTTTTGCAGTCAATAGACAT
GGAGACTTTGATATCAGAGGACGAGCTTCTCTCATACCTG
ATCTTTGGGAAATCTATTTTTATTTCCTTGATTTTTATGT
AAGTAATCACTGCAACACCAAAATCCTCTTGCAACTTTTG
CTGCCATCTTTAAGCCTTAACGAAAGTCATTTAGTTGGTT
TCCAGAAAGACATTTTGCACTGGCTAATGTGCAGGTTTGT
CAACTTTTAAACAACAAAACATTCGGGACTTTTAATAAAA
ATAATGCATCCCCTATAAATGAAAGTTCTACAATTACAAA
GCTTAAATTGTTTGGCTTCTTAGTCCAAATGTGCAAACTA
CACACAATATTATAAGTCTTCTAAAGCCATATGATGCATT
TGGTTAGGACTAAACGGATTTCAATTTAAAGGGACAGTTC
ACCCAAAAAATAAATCTACATTTACTCACCCTACACTTCA
CTTCTTCTGTTGAACACAAAAGAAGGTATTTTGAAGAATA
CTGGTTGATGGCACCCATTGACTTGCATAGCATTTTTTTC
CTACTATAATAGTCCATGAATGCCATCAACCACTAAAATA
TCTTCTCTTTGTGTTCAACATAAGAATGAAACTATAACAG
TTAATAGTTATATAGTTATAGTTCGGGGGGAGGCAAATTA
AAATAACAAAGAGTAAATTACATTTTTTATTACCTGATGA
TCCCCTCATACAAAACTATTGTATAGCTTTAGAAGACTTT
GAACGGTAAAGGGAATCCAATATTATTCTGAAAGTCTTTA
AGCAAAACATGTCCCCACTGTTATGTTGTTGTTGTTGTTT
TTTTCCCTGTTACATATATTGAAATTGAAACGGCATTTCT
GTTCAAGTGTTCTACCCAACTAAACCGCACTGTTCAATAT
ACTCTTCGGAATGGTTTGTTTTTGTTGAAAGATGTTTGAG
AAGCCTGTCACTTGTTCTTGCTGCTTCTGTATATAGATTT
ATAGCTTTGGAAAGCTAACAGCTTTAATACACTTATTCTC
GAATCTTTAATGTGATCTAGCCATAAGGAAGATACACAGC
GGATTGCAGTACACCAGTACGACTGTATAGGTAAGAGCCA
TTAGAGTCTGTCTTCAACGAGTTCAAGATTAAACTTCTGT
GCATTTTTCAACTGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
setd3-201 Contained in:

OTHER setd3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000032887 (1)
  • Ensembl_Trans:ENSDART00000022758 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055261 (1) 3834bp
    CITATIONS (2)