ZFIN ID: ZDB-TSCRIPT-131113-1605
Transcript Name: si:dkey-33c3.1-201
Previous Names: dkey-33c3.1-001, si:dkey-33c3.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022034 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022034|OTTDARG00000018218|ZDB-GENE-131121-337 si:dkey-33c3.1|OTTDARP00000018510 DKEY-33C3.1-001 LG_ BX649559.12 Danio rerio protein_coding PUTATIVE, 1071 bp
ATGGAAGCAGATGATCATTTTTCTTTGAACATCTCGGCGG
CTTTTACCAACATCTCACCAACAGTCACAGGACCCGTCAA
GAGCGCGCCCCCGTCCTCTTACGACATGCTAATCACGTCC
ATACTCGGCACAATTTTAACCATCATGTGTTTGGTGGGCA
TAACTGGAAACGTTTACACATTGATCATCGTGAACACCTC
CGTGCGCGTAACTGGATCGATGTATGTCTACATAGTGAAC
TTGGCTCTGGCGGACCTGCTGTACCTCTCCACCATCCCGT
TCGTGGTCTGCACGTATTTTGCGAAAGACTGGTACTTTGG
AGACGTCGGATGCCGCCTTCTGTTCAGCCTGGATTTCGTC
ACCATGCACGCGAGCATCTTCATCCTGACTGTCATGAGCA
CGGAGCGATATCTGGCCGTCGTGAACCCGCTCGACACCTT
CGGACGTTCCCGGCGTTACCGGCGCGCGGTCACTTTTCTC
GTGTGGCTCTTCTCTCTTATCCTCGCCTTGCCGTCCATGA
TCTTGATTGACCTCAAGATAGACGTGCACAATGGCGTGGA
GAAGCGCATGTGCCACCCGACCTGGCAGATGACTGCGTAC
AGAGTGTACCTGACCGTTTTATTCAACACCTGCATTTTGG
CTCCTGGATTAATCATTGGCTACCTCTACCTGAAATTAGC
CCGGATTTACTGGCTTTCGCAGACCTCAGTGTTTCCTTCT
AGAGAGGTTAAGAGGTGTCCTAAGCAGAAGGTGTTATATA
TGATCTTCACCATAGTTCTGACCTATTGGGCGTGTTTTTT
ACCCTTCTGGTTGTGGCAGTTGCTCAGTATCTACTATTAC
GCGCACGGTGGACTCTCCAGCTATACTGTGGTCTACATTA
ACTTCGTTGTGACTTGTTTGGCGTACAGTAACAGCTGCAT
CAATCCTTTCTTGTACACTTTGCTGACGAGGAATTATCAG
GAATATGTGAGGGACAGACAGAAAAACAGCGTCGAGTTTA
AGAAGAGAGTCAGACTGTCTTCGCAAAGGTCTTTGTCTCT
TTTCAGGGCAAACAGTTCTGTAATACTGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-33c3.1-201 Contained in:
[BAC] DKEY-33C3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022034 (1),  Ensembl_Trans:ENSDART00000154929 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)