ZFIN ID: ZDB-TSCRIPT-131113-1591
Transcript Name: ottdart00000060078
Previous Name: ch1073-310h15.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060078 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060078|OTTDARG00000041673|ZDB-GENE-080721-1 fam69b|no_translation CH1073-310H15.1-001 LG_ CU855788.3 Danio rerio antisense NOVEL, 494 bp
ACTGCATGTAAATCACCCAGCTGGCCACCAGAATCCCAAA
CCACGCCACCAACAGACGACACGCCTGCGCTCTCCTCCAG
CAGGAAAAACACACATTTATCCTGGTATTTTCGTATGTAG
TCGGTCGTGAGATGGAGAAACATCCTGAGCTGATGACGAT
GAGCATGATGATGATGCTCAACTCAAGGACACGCGATCCG
GGCATCATCCGCGCGCGACCACATGTGATTTGGATGATGA
TGGTAATGATTTAAAGAGCTGATCCGACATTTGAAAAGAC
TGGTGTTTGATTCCGATCCTACAGGACTTGTTTTTTTCCG
TCGCACTGTGCGGATTCAGACGGTGAAAGAATGACTGGAG
ATCAGCTGGAGATTCGGCCTCACTGCGACTCCGCAAAAGC
GTCTTAAAGGGGAAGCGAACCTGAATTATGAGCCTGATAG
AAAACAAACTGTACTGTCTCTTTAAATAAATAAAATCGAT
TCAATTTGACTACA

dipk1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fam69b-001 (1) 6118
antisense ottdart00000060078 494
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000060078 Contained in:
[Fosmid] CH1073-310H15 (1) (order this)
OTHER ottdart00000060078 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060078 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)