ZFIN ID: ZDB-TSCRIPT-131113-1387
Transcript Name: si:ch211-69l10.4-201
Previous Names: ch211-69l10.4-001, si:ch211-69l10.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059236 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059236|OTTDARG00000041071|ZDB-GENE-131127-259 si:ch211-69l10.4|OTTDARP00000046236 CH211-69L10.4-001 LG_ CT573344.8 Danio rerio protein_coding NOVEL, 1746 bp
ATGGCTGAAGCAACGTCGAGGTGTCACTGTAGCGTCCCTT
ATTGCTCTAGCAATAAGCGTCGTCAACCATATCTGAGTTT
TCACGCGTTTCCCAGCTGTAAATATGACAGGAAGAAGTGG
GTGCATGTCATTCGACGCGATGAGTCTCTGACTTTTAACA
TCCTCAGAGGCAGCACATATGTTTGCAGCCGGCACTTCAT
TGAGGCGGATTACACTGCCGCCACAGGCCGAAAGCGCCTC
AGAAAAGGGGCCGTTCCATCCCGATTCCACTGGAATAACT
GGGGAGATTCATCACGACTGACGGTGTACGACGGAGGAGT
AGATCGACGGGGACTTGACCCTTCTCAAAACGGCGACATC
GTTCCTGAAGTACCACCAAAAGCTGGAGCAGACCACGACT
ATGCAGTCGCTCCTCTTCCAGGTGCACAGGATGCAGCAGC
AGCACGTATACAGGAACTTGAAGCTGAAGTCAGAAGACTG
GAAACTGAGCTGGGGCAGCTGAAAATAAACCAATCTCTGT
CACAGTTTCAGAGATTTTGTGCTTCAGATGAAGACATACG
TTTTTACACAAGTTTTCCATCTGAAAAAGTCTTCCTAGCA
TTCTGGAAAGCAATTGAGCCCTCTGCGTCCATGATGGTCT
ATTGGTCTCTGGCCCAGAAGAAGGGACATACAGCTGGAAT
GGAAGCTTCTCAAAGCCATCAGCGAAGCCTGCCACTGATT
GATGAGTTTTTCCTATACTGCTGTCATGTTTCTGCAGGTC
TTAAAGAGAAAATGTTAGCAGACATTTTCAAGATTAGTCT
CTCCACAGTAAGTCGTGTCATCATAACCTGGGCTAATTAT
CTTTACCTGATCTTTGGATCTTTGCCAGTATGGATGAGCA
GAAAGCAAGTGAATTCCACAATGCCTGAGAAGTTTAGGTA
GTTCTGTCCAGAGGTGCAGGTCATCATCGACTGCATAGAG
ATAAGGTGCCAGAATCCATCTTCCCTCACACTCCAGTCTG
AGGTGAGTTCCTCGTATAAAAAACACCACCACCATCACAT
TTGTTTCCAGTTCGTTCACTGGTTCCATTTCAGATTAAGA
GTTGACAAAACAGTCAGGCACACTCAAGCTGTTGGAACCA
GGGGATGCTTGCATGGCTAACAAAGGATTCACCATTGAGA
ACATTCTGGTGGAGCGAGGGGCCAAACTCATCATACCATC
TTTCCAAACAGCAACTCAGTACAGCAAAGAAGATGCTGAG
AGAACGCAAGCCATAGCACGCCTTCAAATTCTTGTTGAGA
GAGCCATCAGAAGAGTGAAAGAGCTTCGCATCTGCGACAC
CCCTGTAACCTTGACCATGTCTGGAACAGTTATCCAGCTG
TGGACTAACTGCTGCCTGATGAATAATTTTCAGTGGCCGC
TTGATATTAAGTCAAGTTTATTTATAAACAAATTTTGAGA
GGATCAAGTGCTTATGATTGTCCACAGCTGAGTGGATTAC
AACCTTTCATCAAAGTTGTTCTAAAACTATTAAACAACAT
CCATTCTTGTAAAATGTTGAATACTGTGTGTATGTATGTA
TGTATGTATGTATGTATGTATATATATATATATATTTCAT
GTACATACATATACAACTATACAAACTGATATACATATAT
ACGCATAATGCATATACTCGTGTATAAATGTCAACAAATG
TATATTTTTAAATGTATTATATAAATCTTGAAAAAAATAC
ATTGAATAAATAACATATGTACAACC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-69l10.4-201 Contained in:
OTHER si:ch211-69l10.4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059236 (1)
  • Ensembl_Trans:ENSDART00000155557 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)