Transcript

abhd3-201

ID
ZDB-TSCRIPT-131113-1332
Name
abhd3-201
Previous Names
  • abhd3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059048 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059048|OTTDARG00000040938|ZDB-GENE-040912-90 abhd3|OTTDARP00000046118 abhd3-001 LG_none CU682364.6,CU633747.5,FP017159.8 Danio rerio protein_coding KNOWN, 8371 bp
ATTTCTCTGGGTAGCACATTGAGTTGCTCCGCAGAGCGCC
ACCCATCTCCCCGTGTCTGAACTCCTGTCTCCGTTCACCT
TTGCATTTGGACGCGCATCCTTACATCCAGGGGCAGCCCG
AGCGTTTCATTATCCGGAACCGTGGGTTTTAAAGGGCAAT
GATCTCACTGGAGCTTAATTTCAATTTATTTACGAGTGAC
CTTTCACTTTACCTCAAAAACCAAGTTAAAGTCGGACTAT
TCGGGTCTGGGGTTGGACTATCGGTAGTTCTCGGGTTCAG
CGCCGCTTATGCCTGCTACTACCTGATATCTGTGGCCAAG
AAACCTCTACTGATAGCTGGAGGAAATAAGTTTCATCAGT
TCCTGAGGGACCAATGCCCCGTGGTTTCAGAGACATACTA
CCCCACTTTCTGGTGCTGGGAGAGCAGAGTTCAAACGCTG
CTCAGACCCTTTGTGACTGCGAAACCCTGGGTCAACTACA
GAAATGAGCTCATTAGAGCACCAGATGGAGGCCAGATCTC
TCTGGATTGGTTTGACAATGATGACAGTGTGTCCCACCCG
GACCAGTCCACGCGACCCACTGTGCTGCTGCTCCCAGGAC
TCACAGGCACCAGCCGCGAATCCTACATTCTGCATATGGT
ACAGCAGAGCCGGGATCTAGGATACAGATGCGTGGTGTTC
AATAACAGAGGCGTATCGGGTGAAAAGTTATTGACTCCAA
GGACTTATTGTGCAGCCAACACAGAGGATCTGGAAGTAGT
CATTGAGCATGTCCAGCGGACCATTAACAAAGCTCCGCTC
ATGGCGGCTGGGGTTTCTATGGGCGGGATGATGTTGGCGA
ACTACCTGGGTCGTAAAGGCTCTGAAGTGCGCTTGAAGGG
TGTGGTGGTTTTTTCGGCAGGCTGGGATGTGTTTGAATGC
ACAGCATCATTGGAGAAACCCCTGGACCGATTTCTCTTCA
ACTCTTACCTCACCAGCTGCCTGCAGGCGTCCGTGGACCG
TCACAGAACCATTCTTGAAAAGAAATACGACATAGACCAT
GTGATGAAGGCTAAAACTATACGAGAGTTTGATGAACGTT
TCACGTCCATCATGTTTGGTTATCCATCCAATGATGACTA
CTATAGAGACGCTAGCCCGATTCACAAGATCAAGTCTGTG
CAGGTGCCAATGCTGTGCCTCAACGCAGCTGATGATGTCT
TTTCCCCCAATCACGCTATTCCAGTGGAGGCCGTGAAGCA
GAACCCCAATGTGGCCCTCCTCATCACCTGTCATGGTGGC
CATATTGGCTTCCTGGAGGGTCTGTGGCCTCGGCAGAGCA
CCTACATGGACCGCGTTTTTCGTCAGTTCACCAAGGCTGT
GTTTGAGAATGGCAATGGTCTGGATGATCTCTACTGACCC
TCTCATTCCATTCCCTCAACAGAACAGCTGTGAGCAAAAA
AAAAAAAAATTATTCATTTCCAAAATGACAGGCACAGGTT
CACTTGAAGGCCAGAATAGTTTTTTTTAAGTCTAGTCATA
TATTTATTGAATTATTTTAGTAGTGTTTTAACTTTTTGAT
TTTCATTTATTGAACAAAAATGATTCTTTGACTTGCACAT
TTGTTCATCCGTCCATCAGTGCACTTATTTGTTTCTAAGC
TGCATTCATCTGTGACTTGCATGCGTGTGTATGACTCTCT
TAATTATGTAATTTTATATATGCTTTAACTCTGAAGGGCA
TGATAAACCATCCAACCAACTGAAGCACTTATTTAGATGA
CATTACTCAACATTATGTGGAGAAGTGTACTAAATCAAAA
TGAACCTAAATCAAATCAGCACTAAAGAAAAATAAAAAAT
AAGAATATGTAGCTGCAGAAAGAAAATGAAGCCTAATTTA
GAATAACTTCATTACTGTAATGCAAAATAGTCTCGTTCCT
GTTTCATAATGCAGTGCTAAGTATCATCGTGGATATATTT
ATGGAATATGGGCGACATGGTGGCTCAGTGGTTAGCACTG
CCACCTCACAGCAAGAGGGTCACTGGTTTGAGTCCCAACT
GAGTCAGTTGGCATTTCTGTGTGGAGTTTGCATGTTCTCC
CCATGTTGGCATGGGTTTCCTCCACAGTCTAAAGACATGT
GCTATAGGTGAATTGAATAAACTAAATTGGTCGTAGTGTA
TGTGTATGAATGAGGGTGTAAGGATGTTTCCCAGTACTGG
GTTGCAGCTGGAAGGGCATTCCCTGTGTAAAATATATGCT
GGATAGGTTGCAGCGACCCCTGATGATTAAGGGGACTAAG
CTGACGGAAAGGGAATAAATTAATAAATACACTGTCAAAC
CCAAATGTTAAGGTAATTCAAACCATTTGAGCAAACCGAT
TGCTACAAACCATTTGTTCAAAAACTTATCCTAATGAGAA
CTGTGAACTTAATCTATTTGAGTAAACGAAGCAATTTGAG
CACAGTAACCCCTGATTAATGAAGAGAACTCAAACTAAGT
ACTGTAAAACCCAGTAAGTTAAGGCAAATCAAACCGTTTG
AGAAAACCAATTGCAGCAAACCACTTGAGTTAAGCTAATT
TATATGAGTACTTACTCCATTTAAGTTGAAGTAATGAGGT
ATTTAATTAACTCTTTGCCTTCAACACTGAGTTAAAAACT
CTTTTCAAATGAGTAAAATTTACTTTCAGTACATTTTGAG
TTAACTACTCTCATTTTATTTGATAAAGTTGACTGTTGGG
TTTTACAGCGTATTTGTAGAATTATTCCTCCAAAATGACT
TTACTCATCCTCTACATGTTTTAAACCTATTTGAGTTTCT
TGTGGTCAACACAAATAAGATATTTTGAGGAATGTTTGGT
AACCGGGAGCTATTTTCTTTCATAGTATTATAAAAGTAAC
TGGCTATCAGTTACCAACATTTTTTAAAACATAATCTTTT
GCATTTACCAGAAAAAGAAACCGCATGAGGGTGAGTAAAT
GGTTTATTTTTGGGTGTACTATCTTTTAAGATAATATATA
TCAAAATAGTATCAGGGTGGCCCAGTGGCTCATGGTTAAC
ACTATCGCCTCACAGCAAGAAGTGTGCTGGTTCGAGCCCA
AGCTGGACCAATTGGCATTTCTGTGTGGAGGTGTGCTGAT
TCGAGCCCCGGCTGGGCCAATTGTCATTTCTGTGTTGAGT
TTGAGTATTTTTTTCCATGTCCACATGGGTTTGCTCTGAT
TTCCCTCACAGTCCAAATGCATATGCTATAGGTGAATTGA
ATGTATGTATGGGTGTTTTCCATTGTTGGGTTGCGGCTGG
AAGGGCATCTGCTGCGTAAAACATATGCTGAATATGTTGG
CGGTTCATTCCATTGTGGCGACCCCTGATTAATAAATGAT
TAAGCCAATAAGAAAATGATTGATCGAATGTCCAAAGTGT
GTGAATGCCAGAGTGTATGGGTGGAAGGGCATCCGCTGCG
TAAAACATGTGTTGGATAAGTTGGTGGTTCATTCCGCTGT
GACGATCCCTGATTTAAAAAAAGGATTAAGCCAAAGGAAA
ATAAATAAATCAATGAAAATAATATTAGCGAAATATTTAC
AATTGAAGTTTTTTATGAAAAGATTTTTGGTTAGTCAGGG
TGGTAAATATATCTTTTAGGCCATTTAGTTTTTAAAACAT
GGAACCTCCAAAGGAACAGAATTTATCAGAAAAAAAACAT
AAGAGCTTCTTTAATTGTCATTAAATAAAGAAAAAAATAA
AGAAAACAGCTCAATACCTTTGTTAATAGATTTAGTCAAA
TTGCACTATATCAAATTGTGATTGTAGCCGTGAAGGTCAA
GGGCATTTGTGCAGTTGTTTTTAATTATAAAAAAGGATTT
CACCTAAACTCTTCCAAAAAAAAAAAAAAAAACGATGCAG
TGAAGCAAGGAGGTCATATTCCAGCTCCACTTTTACCTTC
TTATGTAAACATAAAAGATTAATTCAGTGTTTATCATACC
ATGTTTGACCTCCTACATGTCAATGACCATTTATCCTAGC
AGTTGATATGCTGCACCAAGGCCTTATCAGTTTGGTCCAT
TCTAGTGTTAAAAGGAAGCTTTATATATTATTATCCGTAT
TTTCACCATGTATCTTACATGTCTGTTGTTTTGTAGCCCT
CAGGACTGACCCCAATTTCTCTTTTTTGTTTGAGTTTCAT
GTAAGTGTCATGTTAGTTTGCATTTTTAAGGCAAGAAAAG
ATTGTATTTACCATATCACGGTTTTTAAGTTTCCAAAAGA
ATGTACCACACGCACTTTGTTTCTCATTCATTACTTCAAT
GTTGACACTGACTACTTTGTGAACGATAAATGAATCATTT
TGACTTGGAATGTGAAATTTGTTGTTGTTGATGGCATTAA
ACCTGTGGAGGTAAAGTGTGTTATTTTGGACTTAACGAAA
GTGGCTTCAAGGATTCTGTGAATGTGAAAACGACTTGAGC
TACTGTTTGTCTGAACATTGTAAAATATGTTACATGCTTT
TAATATATGCTTTAAATTCACTTAAGACTCAAAATGCTTT
TTATATTAATGCGCCAATGAATTCTTAAAGAGATAGTTCA
CCCTGAACTGAACATGTACGATGTACCTCAGACTTTTTTT
TTCCTACAGTAGAACATCGAAGTACATTTTTGCTGAAACT
CTGGTCTTTGGTAATTCACAGATTGTCAGTCAGTAAATAC
CATCGGCACTTTAAGAGTCAAACAATCATGAATATGCAGG
ATATTTTATTTGTGACATTACCCAGCAGGCACACAATGTC
ATATGATACTCTAGGTAGTTGGTTATATATTGGTTGCGAC
TTCTTAACGTCATAATGTGATGTTCATACAACGCCAAAGT
CTAACATCAATATGCGCTGATCTTTGGTTTTTATTTGTGG
CATTAACTAACAAAAATTCTAAATCATATTAACATCATAA
TGTGAGGTCCATACAATGTCAAAGTGTAACATCAGTAGAC
GCTGATCTTTGGTTGGTTTTAGGTTGTGGAACTAACCAAC
CAAAGTTTAACATCATCTTAACATCATAATGTGATGTCCA
GATAACGTCAGAGTTTAACATCAGTAGACGCTGATCTTTG
GTTGGTTTTAGGTTGTGGAATTAACCAACCTTAGTTTAAT
GCCGTTTTACCATCATTATGTGACATCCATATGACGTTAA
AATGTAACAATGGTAGACATTGATCTTTCGTTGGGTTGAG
GTTGTGGAATTAACAAACCAAAGTCCAACATCATATTAAC
GGTATAATGGGATTTCCATACAATGCCAGTGTAACATCAG
TCGACGCCGATCTTTAGTTGGTTTAAGGTTGTGGAATTAA
CCAACCAAAGTCCAACGTCAACATAACGTCATATTTTGAT
TTTCGTATAACGTCAAAGTCTGACATCAGTAGACCCTGAT
CTTTGCTTGGTTTAAATTTGTGGCATTAACTAACCAAAAT
CTAAAATCATATTAACGTTAAAATGTGATGTCCATACAGA
TGTTGATCTTTGGTTGGTTTTAGGTTGTGAAACTTACCAA
CCAAAGTCCAACGTCATCTTAATGCCATAATGTGATGTCT
ATTCAATTTCAAAGTGTAACAAAAGTAGATGTTGATCTTT
GGTTGGTTTTAGGTTGTGGAATTAACCAGCTAAAATTGTA
CAATGTCAATCTAATGTTCTGTGCCTGCAGGCTACACTGA
GGTCTTAAAATTTACAAATTAAGCTTATGCACAGAACTGG
AATATTGCATTTCTATAAACATTTGCAAAAAAAGCACTAT
TTTCATCCAAAAAAAAAGCAAATACAACAAAACGGTCCCT
TCCTAATAAATTGGCACCAAATATCAAAAAGAAAAATGGA
ATTTTACTTATGGTAGGAGAAGCCACTGTGGGCCTTTTTC
TTATATAATAAATTACTTGCACCTCAGAAGACAAAAACGA
AATTAACTGAATGAAATTATAATTGGTTTTTGGAGGCTCG
AGACTACTCTTTAGGAGTTCAGTCTCTCAAATAGTTCTGC
TAGATGATAATACTGAACCACTTTAAAGAGAGACCTAAAG
CTAAAAAGTCATTTTAGAATGTTTAGACCAAAACAACATT
TCAGATATCGGGCAATGTGGTTTGACCACTAGTTTGTCTA
TTAATGGCATTCCATTGTGCCCCAGATTTGACAGAAAGTG
AAGTTTATCTATAAACAAATTTCGAGAGAATCACATGCTT
ATGATTGTTCACAGCTGTTCCAACTTTAGCTAATGACTGA
TTATCCTATCAGACGATCCTTAACTCAATATAAATAACCA
GACTTTTCTCATCTTAATATCTTTGTCTTGAAGAAACCCT
CCCACCCAACCCTACTTTTCCTCCTTTCAAACAGGTGACA
CGGTGGCCAGTGATTAGCGCTATTGCCTCACAGCAAGAAT
GCCAGTGGTTTAATTCCCTTTCAAACCAGGCAACATTTCT
GTGCGGAGTTTTGCTCGTTCTCCCCGTGATTGTGTGGGTT
TTCCCCGGGTCCTCCGTTTTCCTCCCACAGTTTAAAAACA
AGCACCCTAATCAATTAATCCAAAATATTTTAGCCAAACT
CTGAGTACACCTTTTCCGCATCCATATCCGACACTTAGCT
ACTATAAGCAGGAGGGGGAGTCATTGCGATCTACCTAAGC
TCAAACTCCCCTCTCGCCTTGCAACAGGAGGGAGCCCAGG
GCTCGAGGATCTTATAAGCTTAGAGCTCTCTCCCGGGACA
GCGCGCCAAACAAGCTTTATTATTAATCATCAGCTAAGTG
TGAACTCTTGAAAGCTTTTTTATGATGATAATATTATCTT
TTAAAACTAAATCACATGACTTTTTTATGCTGGTGAATGT
GTTTATGGTAAATAAACAAACAAAAATATGATTGATGTGT
TTCCATTGTACTTTATGCACATTTTTTCTTACATAATAAA
AAGTTTATCCTACTCAAAATTAAGGAGCGTATTGGCATTT
CCATTTAGATTTTTTTTTTTTTTAATGCGATAGTTCAAAA
TGCGCATAAAAATCTGTGTATGAAAGTCAGTGGTGGAAAA
AGTACTGAAAAATCTTACTCAAGTAAAAAAAAGGACCATT
CCTTGCCCAAATGTAGTGCAAGTAGTCAAAGTATCTGTTG
TAAATATTACTCGAAGTATGAGTAAAAAGTAGTCCTTTCA
AAAAGTACTCAAGAGTAGTGAGTAGTGAGTATTACACTTT
GAAAAGCTGATACATTTACATGTAATTTGTGTATGTGTGT
AAACGTAACATTCTGTAGTGTATTTAATTATGGCCCAGCA
GGCACACAACGTCATAAGCTCATATTAGGTTAGATTTAGG
TTGTGATGTCAGGTGACCAAAATTCTATGTCTAACCGGCG
TCTAAGGACAACATTATTTTGACGTTCAATAATGATATCA
AATGACGTTGATATTTGGTTGATTTTAGGTTGTGTTAGTG
ACCATCTATAGCTTTAATCTAACCTCATATTAATGTCTTA
TGATGTTGTGTGTCTGCTGGGAAATGTTTCCATCTATTAT
TATTTTCATTAACCCTTTTTCACACAGGTCCAAAACCACA
TCAAGCAAGCAGAAAAACTTTTTATGCGTGTGAATTCAGT
GATTTGCATGCAAAATATATAATTTTTTAATGTTGTTGTT
TGTTTGTTTTTGACTCTTAAGTCCTGGTAGCCATTTTCTT
GCATTTTATGAATCACCCTAGACCAGTTTCAGCTAAAATA
TTATTTAATGCTACAAAGTCACCTACTAACCTAAATATCT
TTTGAGGTTCGATTGAACTATCTCTTTAAATTAGGCTATA
TAAAAAAACAAGAGAAAAAAATCTTGAGCAGCCATTATTT
GTGTGAGAATGACAGGAAGAGTTCAAAACAAAATAAAAGA
TGTACGTATGCCATTGTGATTTGACGAGAAAGCTGTAAAT
AACTATGCCCAAATATAACTTTAAATTTTCATAGAAGAAT
GACAAGATGTCCCAAACTAGATCTTATTAAAACGGCCATG
CGTTGTATATTGACCATCGTCTGTTTTTTCTTATGGTGCT
GCTTCATATTGCTGCTTCTGTGGACTTTTAAAAAAAACGC
TTTCCTCTCTGCTTTCCGTCCATCCTGTTTCCGAGTAGCA
TGTGTCACTGTTCTAAGTGTCTTGAGTAACTGTACAGCCA
TGCATTGCATAAACCTGTAGCACAACAGACATGTTTTTTT
CCTCCCCAAGATGTCTTTCCTTTTATAGATTTATAAAAGG
ATTGTGTAATTAACATGTGCAGCAATACGATTTTAAGACA
AGATTTATGTCTCTGTAGAATAAATATATGCACATGTACT
TGGATTATGAGTGCATTTGTGGTCTTAAATAAATGATGGA
ATTAAACTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations