header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1312
Transcript Name: wnt9a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058888 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058888|OTTDARG00000040826|ZDB-GENE-060825-97 wnt9a|OTTDARP00000045986 wnt9a-002 LG_none FP245476.3,FP102374.4,FP245396.14 Danio rerio protein_coding KNOWN, 1045 bp
ACACAGCAACTCAGGACGAACGAAATGAGCTGCCCCAGAG
CCGCTACAAAATGCTGGATGGACACCTTCTCCTGGGATGG
TTATCATTTACCATTATAGTGCATCTGATCAGCCTGCCCG
GACCGAGCACGGCTTACTTCGGGCTGACAGGTAATGAACC
CCTGTCCATTCTGCCACTGACCTCACAGCCAGACGAAAGG
GCGGGAAAATCGCACTACAAGCTGTGTGATCGACTCAAAC
TGGAGAAGAAGCAGCGCAGAATGGCCGATACAGGGCTAAC
ATTTTAAAGAGAGGCTTCAAGGAGACGGCGTTCCTCTACG
CTATTTCTTCAGCGGGCCTCACCCACGCCATGGCCAAAGC
CTGCAGTGCTGGCCGAATGGAGCGATGTACCTGTGATGAG
GCTCCGGACCTGGAGAACCGCAAGGCTTGGCAGTGGGGAG
GCTGTGGAGACAACCTCAAATACAGCAACAAATTTGTCAA
GGACTTCCTGGGTAAGAGGTCAAACAAGGACCTCCGTGCC
CGGATAGACATGCACAACAGCAATGTAGGAATGAAGGTGA
TCAAGACTGGGGTCGAGACCACCTGTAAGTGCCACGGCGT
TTCGGGCTCATGCACCGTGCAGACGTGCTGGAGGCAGCTG
GCGCCCTTCCACGAAATTGGCAAGCAGCTCAAACAGCGCT
ACGAGACGTCGGTCAAGGTGGCCAGCTCCACCAACGAGGC
CACCGGGGAGGGCGAGATCTCCCAGAGTCGCTCCCAGAGC
CAGCAGCCCCCCCAGCCGGACATCCCCCGCACCCCAGATC
TGCTACACATCGAGGACTCGCCCAGCTTCTGCAGGCCGAG
CAAATATTCGGCGGGCACGTTGGCTCGTAAATGCTACAAG
GACAAGAACTGCGAGGCCATCTGCTGTGGCAGGGGACACA
ACACCCAGAGCCGGGTGGTGACCAGACCGTGCCAGTGCCA
GGTGCGCTGGTGCTGCTATGTCGAATGCAAACAGTGCACA
CAAAAAGAAGAGGTTTACACCTGTAAGGGGTAAAAAAAAA
AACAA

wnt9a TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript wnt9a-002 1045
mRNA wnt9a-201 (1) 1158
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wnt9a-002 Contained in:
OTHER wnt9a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058888 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC122352 (1) 1049bp
    GenBank:GQ927508 (1) 1049bp
    CITATIONS (1)