Transcript

si:dkey-79d12.4-201

ID
ZDB-TSCRIPT-131113-130
Name
si:dkey-79d12.4-201
Previous Names
  • dkey-79d12.4-001
  • si:dkey-79d12.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048582 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048582|OTTDARG00000034348|ZDB-GENE-131119-45 si:dkey-79d12.4|OTTDARP00000038109 DKEY-79D12.4-001 LG_ BX005256.11 Danio rerio protein_coding PUTATIVE, 2602 bp
AACGAATATTCTAAAAAAGTAATGACAGTATTCGTTAAAT
TTTTTTAAGTGTTGCGCATGCGCAATATAGATTTGTTGGC
CGGACAAATTTAGGAGACGTACTCGCGCGTGCGTGCAGGA
ACTGAGGGAGGAGCTACAACCAAAACACGAAAATTATTAA
AGAAATCGAATTATTCTCAGTAAATTCCTCGGTTAAAACA
GGTGCTAATATGGAAGTCTTGCCGTTTGAGAAGGTGGAGC
GTGTTGTTGGTGCCAGAAAGAAACTGCAGCAGAAAGCTCT
TTACATTCAGAACTCAGAGTACTGCAACAACCTCATCTCA
ACATATTACAGCTTCTCTGAAGACTCCAGTGATGAGGAGG
AATACAAAATACCACTGGCGGCTAGTGAGAAAAGCTCTGT
GTGCTGTGTTTGTGGAGACAACATCCCCTTCCTGGATAAA
CTGATAGAGCACTTTAAGACACACACAGCGGTGGTGTATT
GTCACCTGTGTCACACAAAGTTTGGCCGTGTAATGTCACT
AGCATTGCACCTAAAAAATGCCCACGCAAAGGACAGTCAC
TTATGTGAAGTTTGCGGAGCTCTCTTTAGTTGCACATGGC
ATCTCAATGGGCATATAGGAATGCATCAGAAAGACAACAT
GAAGGTAAAACCTGTTGTTAAAAGCGAGGAGACTGAAGCA
GTCAGCATCGCCAAGACCTCAAGCTGCATTGATTTGAAAA
GAGCAATCACCATGGATCATACATATTTTGACGCGGAACA
AAATGTGGCAAGCAACACGTCCAGTCGTTTGCAGAAACAC
ACTGATGGTGAAACTAACTCCATCGATGAAAACCTACACA
TTAAAACAGAAGCTGAAAGTGTGCCTCTTGATGAAGTGAA
ACAAAATGAAACCTTCAGCTCTTCGTCCTTTCAGAACCAA
ATAGAAACAGAGCACCTTAGTTTTGAACTAAAGGAAGAGA
ATGACAATGAGCTTGAAGACATGTCCATTTACAAAGTGGT
CGCAGAGGAGGTCATTGGCCCGACAGGGGATGAAGAAAGT
ACAGACACTGATGAGGATGCCAACCCTGACTCGCTGCCCC
CAGGTGACACGGCATACAATCCAGACGAGGACTTCAGCTC
AGATTCTGATTATAATGAGTCTTGCAGATCTCAGCAAAAG
AGACTGAAGCCACAGACGCCTGACAAGAAAGCATCTGTGA
ATGCGAATCGGGATTTGACTGACATTGAGAAGAAATTTTG
CTTTCAGTCCGATTCTCCCTTTTGCTGCTATGGTAAGTTC
GCCAATTTGGGAAAGCACATGGATGATTGCAGTAAAAAGC
GGATGATGTCTTGTTGCCTGTGTAAGGTGGCATGCAAGAA
TGAAGAGTCGCTTTTAAAGCACATGACCGAAAAACACCCT
AAGACTTCATATATCTGCTCGACCTGCCGCAAAGTTTTCC
CTAGACAGGAAAATTTAAAAAATCATGTGTGCTTGATACC
TAGAGGCAACATGGTCACCCCTCTAACCCAGTTACCCAAC
ATGCCTTTGCCTTATAGCAGCGGTCAGGGAAAGCCCATTG
CCTCTGCTTTGCACACCAATCAGAGCACTGTTAAAATTCT
TAACTTTATTCCAGCAGTTAACAAAGTTTCCACTGATCCT
CCACGCCCAGTGGCGTCCTTGGGGTCTACAGAAGCTCTGA
CGCTGCACCGACTGCTTCAGACCACTCCTGCGGTCACTCC
TAAGGTGACTAATTTGGTTCCACAAGTTGTAGCTGTCCCA
CAAACTCTTATGAGATCCAGTTTCGCATTTGTTTCCCACC
CTAACATTCCTGTTTCTACACCTTCAGTAGTGCGTCCCTT
GTTGTTGAATCCACCGAGGTTGACTATTCGTGTCCCTACG
CCTTCCAGTCGTCCTCTTCCAATTGTCGTTTCTTTTTCCC
CCACTGTGAACACCATCACGCCTGCTCTGGTATCCTCCAG
CAGGACTGCTCTCAGACAAAGGCCTGTGCCTAAGATTAGA
CCTGTACCAGTCAACATCCCGCCGGTCACCTCAGTTGCCT
GTCCCACCCTGGTAAGCGCTCTTACCAGGAATAACCAATC
TCAGGTTCCTCCTGCCCAGATTCAGGCTCCGTTACGAATA
GTCGGCATGTACATGAACCACATGGCTCTGCAAAAGCCTC
TCGAGCAGAGCTGGAGCTCCAAGACCATCTTTCCCTGTCG
TCACTGCGGTGCTGTTTCCAGACAACCGTCGATGAGGGTC
CGCCATCGCTACCTTCACCGTGGGTCAAGGTTGTACAGGT
GTCAGTGTGGAAGGTCTTTTCAAAGGCAGCTGCATTTGCT
GAGGCATCAGGTCCAGCATGCAGAGTCGGTTCAGTTTGTT
TGCACGTGGTGCGGAAATACGTTCAAAGGGGCGCATGAAC
TGACCTCCCACAAACGGAAGCATAAGAAAGGTACGCGGCA
AGTGAAGAAGAAATGCAAGGTGGTCTTTGACTGTAGTTGC
GGACAGATATTTGCAAGGCCATCCGCGTTGTTGTGGCATA
TGCTTAAAAACACAAAACACACTGGAAGAAACCCAAAACC
TGTCACTGTTTTGAATTGTTTGAATAAATGAGATGAAAGT
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations