ZFIN ID: ZDB-TSCRIPT-131113-130
Transcript Name: si:dkey-79d12.4-201
Previous Names: dkey-79d12.4-001, si:dkey-79d12.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048582 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048582|OTTDARG00000034348|ZDB-GENE-131119-45 si:dkey-79d12.4|OTTDARP00000038109 DKEY-79D12.4-001 LG_ BX005256.11 Danio rerio protein_coding PUTATIVE, 2602 bp
AACGAATATTCTAAAAAAGTAATGACAGTATTCGTTAAAT
TTTTTTAAGTGTTGCGCATGCGCAATATAGATTTGTTGGC
CGGACAAATTTAGGAGACGTACTCGCGCGTGCGTGCAGGA
ACTGAGGGAGGAGCTACAACCAAAACACGAAAATTATTAA
AGAAATCGAATTATTCTCAGTAAATTCCTCGGTTAAAACA
GGTGCTAATATGGAAGTCTTGCCGTTTGAGAAGGTGGAGC
GTGTTGTTGGTGCCAGAAAGAAACTGCAGCAGAAAGCTCT
TTACATTCAGAACTCAGAGTACTGCAACAACCTCATCTCA
ACATATTACAGCTTCTCTGAAGACTCCAGTGATGAGGAGG
AATACAAAATACCACTGGCGGCTAGTGAGAAAAGCTCTGT
GTGCTGTGTTTGTGGAGACAACATCCCCTTCCTGGATAAA
CTGATAGAGCACTTTAAGACACACACAGCGGTGGTGTATT
GTCACCTGTGTCACACAAAGTTTGGCCGTGTAATGTCACT
AGCATTGCACCTAAAAAATGCCCACGCAAAGGACAGTCAC
TTATGTGAAGTTTGCGGAGCTCTCTTTAGTTGCACATGGC
ATCTCAATGGGCATATAGGAATGCATCAGAAAGACAACAT
GAAGGTAAAACCTGTTGTTAAAAGCGAGGAGACTGAAGCA
GTCAGCATCGCCAAGACCTCAAGCTGCATTGATTTGAAAA
GAGCAATCACCATGGATCATACATATTTTGACGCGGAACA
AAATGTGGCAAGCAACACGTCCAGTCGTTTGCAGAAACAC
ACTGATGGTGAAACTAACTCCATCGATGAAAACCTACACA
TTAAAACAGAAGCTGAAAGTGTGCCTCTTGATGAAGTGAA
ACAAAATGAAACCTTCAGCTCTTCGTCCTTTCAGAACCAA
ATAGAAACAGAGCACCTTAGTTTTGAACTAAAGGAAGAGA
ATGACAATGAGCTTGAAGACATGTCCATTTACAAAGTGGT
CGCAGAGGAGGTCATTGGCCCGACAGGGGATGAAGAAAGT
ACAGACACTGATGAGGATGCCAACCCTGACTCGCTGCCCC
CAGGTGACACGGCATACAATCCAGACGAGGACTTCAGCTC
AGATTCTGATTATAATGAGTCTTGCAGATCTCAGCAAAAG
AGACTGAAGCCACAGACGCCTGACAAGAAAGCATCTGTGA
ATGCGAATCGGGATTTGACTGACATTGAGAAGAAATTTTG
CTTTCAGTCCGATTCTCCCTTTTGCTGCTATGGTAAGTTC
GCCAATTTGGGAAAGCACATGGATGATTGCAGTAAAAAGC
GGATGATGTCTTGTTGCCTGTGTAAGGTGGCATGCAAGAA
TGAAGAGTCGCTTTTAAAGCACATGACCGAAAAACACCCT
AAGACTTCATATATCTGCTCGACCTGCCGCAAAGTTTTCC
CTAGACAGGAAAATTTAAAAAATCATGTGTGCTTGATACC
TAGAGGCAACATGGTCACCCCTCTAACCCAGTTACCCAAC
ATGCCTTTGCCTTATAGCAGCGGTCAGGGAAAGCCCATTG
CCTCTGCTTTGCACACCAATCAGAGCACTGTTAAAATTCT
TAACTTTATTCCAGCAGTTAACAAAGTTTCCACTGATCCT
CCACGCCCAGTGGCGTCCTTGGGGTCTACAGAAGCTCTGA
CGCTGCACCGACTGCTTCAGACCACTCCTGCGGTCACTCC
TAAGGTGACTAATTTGGTTCCACAAGTTGTAGCTGTCCCA
CAAACTCTTATGAGATCCAGTTTCGCATTTGTTTCCCACC
CTAACATTCCTGTTTCTACACCTTCAGTAGTGCGTCCCTT
GTTGTTGAATCCACCGAGGTTGACTATTCGTGTCCCTACG
CCTTCCAGTCGTCCTCTTCCAATTGTCGTTTCTTTTTCCC
CCACTGTGAACACCATCACGCCTGCTCTGGTATCCTCCAG
CAGGACTGCTCTCAGACAAAGGCCTGTGCCTAAGATTAGA
CCTGTACCAGTCAACATCCCGCCGGTCACCTCAGTTGCCT
GTCCCACCCTGGTAAGCGCTCTTACCAGGAATAACCAATC
TCAGGTTCCTCCTGCCCAGATTCAGGCTCCGTTACGAATA
GTCGGCATGTACATGAACCACATGGCTCTGCAAAAGCCTC
TCGAGCAGAGCTGGAGCTCCAAGACCATCTTTCCCTGTCG
TCACTGCGGTGCTGTTTCCAGACAACCGTCGATGAGGGTC
CGCCATCGCTACCTTCACCGTGGGTCAAGGTTGTACAGGT
GTCAGTGTGGAAGGTCTTTTCAAAGGCAGCTGCATTTGCT
GAGGCATCAGGTCCAGCATGCAGAGTCGGTTCAGTTTGTT
TGCACGTGGTGCGGAAATACGTTCAAAGGGGCGCATGAAC
TGACCTCCCACAAACGGAAGCATAAGAAAGGTACGCGGCA
AGTGAAGAAGAAATGCAAGGTGGTCTTTGACTGTAGTTGC
GGACAGATATTTGCAAGGCCATCCGCGTTGTTGTGGCATA
TGCTTAAAAACACAAAACACACTGGAAGAAACCCAAAACC
TGTCACTGTTTTGAATTGTTTGAATAAATGAGATGAAAGT
AA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-79d12.4-201 Contained in:
OTHER si:dkey-79d12.4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048582 (1)
  • Ensembl_Trans:ENSDART00000155217 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB911751 (1) 497bp
    CITATIONS (2)