Transcript

gria4a-202

ID
ZDB-TSCRIPT-131113-1298
Name
gria4a-202
Previous Names
  • gria4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057940 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057940|OTTDARG00000040380|ZDB-GENE-020125-7 gria4a|OTTDARP00000045375 gria4a-001 LG_ CU657957.7 Danio rerio protein_coding KNOWN, 1407 bp
GAACGCCGGTAAACCTGGCGGTGTTGAAACTGAGTGAAGC
AGGAGTGCTAGACAAACTCAAAAATAAATGGTGGTACGAT
AAGGGCGAGTGCGGACCCAAGGACTCGGGAAGTAAGGACA
AGAGTTCGCAGGCTCTGAGCCTCAGCAACGTGGCGGGGGT
TTTCTACATCCTGGTGGGCGGCCTGGGTCTGGCCATGCTG
GTGGCCCTGGTCGAGTTTTGCTATAAGTCCCGCGCCGAGG
CCAAGAAACTGAAGCTCACCTTCTCGGAAGCCATGAGAAA
CAAAGCCCGCCTGTCAATCACGGGCAGCCTGGGGGAAAAT
GGGCGTGTCCTGACGCCAGACTGCCCTAAGGCCGTGCACT
CTGGCCCCTCCTACCGACATGGCCCCGCCCTCGCCGTGGT
GTCCTCCTACCTCCCATAGAAACCAAAAACTCACCTTGTG
CCTTAAACCATCTTATCCGAAGTTCAGAAACACGCCGGCT
TGCGCTTCCCAGGGATTTGGACCTGAAAAGAAAAACAATT
CAGCCCTCGGGAGGAAAAAACAGACAAAAAAAAAGACGTC
AAAAATTGTAAACAAACACTGAGATGAACGTTTTGACGCA
GTCGAGCATCAAGGATCCGTGATGCCTTAACTGAAGCCTT
TGGGGAGAAAAAAACAACAATGAGATGAAAAAAAAATCAC
GTAGAAGACCAGATAACTGTACATGTAAAGACATTAGCTG
CGCTTCCCTGTTCAGCATTATTAGACGTATTAACTCACAA
CAGAACGACGCATTTGGTCCACTAGCTGTATTTACTAAAC
CGTATGTAGATATTCTCTCAGGAGCCATCCGAGGAGGACA
ACGACGTTCATTTTGGGAGAGGAGAAAAGTGGGAGCCGCT
TGCTTTTTATTTTATTTTATTTGTATCTTTTCGGGACTGA
ATTGTAAATAGACCAGTAGTAAAAGCTGAACACGATTCTT
TTATAAAGCATCTTAGGTAATAATTCATTGCAATAATGAC
CATAGGGAGAGACCTGACTTGTAATTAAGAGACCTTTTAT
AAAACACACAAGTATTATTATTATATCTACAGAAACGAAT
CTATATAATAGAGGGACTAAAAACAGCACCGTTTGCGTGT
GAGACCATGGCATCTGTTCTGTTAACAATTGTTTTTGATA
ACTGATGTAACGCAGTGTGTGTTCGTGTCTTTGTCTTTAA
TGAATGTCCACGCATTTCACCGTTCGCACAAACACACATG
TACACACACACGGACACGCGAGCGTATGTGAACGCCGCAC
CGCATCATCACAGCAGGATCACACACACCGACTCCTGACT
CTCACGTTTGGTGTTTGGTTTTGTTTTCTTTTGCTTTTCT
CTTTGTACCCACCAATTCAAATAAAACTGGAACATTTATA
CTATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations