Transcript

ssh2a-202

ID
ZDB-TSCRIPT-131113-1208
Name
ssh2a-202
Previous Names
  • ssh2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057511 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057511|OTTDARG00000040094|ZDB-GENE-030131-3810 ssh2a|OTTDARP00000045069 ssh2a-001 LG_ BX088540.6 Danio rerio protein_coding NOVEL, 4114 bp
CCTCATCCTAAGCAACTGTTAAGCGCTGTTTAGTGGTTTG
ACAGCTGGCACGTACAGCGCATGCGCAGAACGAACAAGTC
GAAGCTCGAAGACGCGGCTGCACATCTTCCTCTGTGCGAC
GGCACCAAATGATGTGAGTTTCGCCGCTATCTTCTCTGTC
ATCTCGCGTTTCTCTACCTTGAATGGCGCTGGTCACCGTA
CAACGGTCGCCAACCCCGAGTACATCATCCAGTCCGTGCG
TGTCGGAGGCAGGCAGTGCTGAAGATGACCGGCGCTCTCA
GCCCAGGAGTATCAGCGAGAACTTCCTAACTGTGAAAGGT
GCCGCCCTGTTCCTCCCGCGGGGAAATGGCTCCTCCTCTT
CTTCAGCACCCCGCATCCCACAGCGGCGCAACAAACACAC
AGGTGACCTTCAGCAGCATTTGCAGACCATGTTCACCCTG
CTGCGTCCAGAGGACACAATTCGCCTGGCTGTCCGGTTAG
AAAGTGCTTATGCTGTCCGTACACGGTACATGGTGATCAT
TTCCACCAATGGTAGACAGGACACCGAAGAAAGTGTGGTG
CTGGGAATGGATTTCAGTAACTCAGACCGAACTTGCACTG
TCGGGCTGGTTTTACCCTTATGGAGCGATACGCTTATACA
CTTGGATGGAGACGGTGGCTTCAGCGTGTCCACCGTTAAC
CGCGTCCATGTCTTCAAACCAGTCTCCGTGCAGGCCATGT
GGTCAGCCTTGCAGTCCCTGCATAAGGTTTGCGAGGTTGC
CCGATGTCATAACTACTACCCCGGCAGTCTCTTCCTGACC
TGGGTTAGTTACTATCAGAGTCGCGTGACCTCCGATCAGC
ACTGCATCAATGAATGGAACGCAATGCAAGACGTGCAGTC
CCACCGTGCAGACTCTCCTGTGCTGTTCACTGATGTGCCA
ACTGAGAGAGAGCGAACGGAGAGACTGATTAAGACCCGCT
TGAGAGAGATCATGATGCAAAAGGACTTGGAGAACGTCAC
TTCGAAAGAGATTCGGACTGAGCTAGAAATGCAAATGGTT
TGCAACCTGCGAGAGTTCAAGGAGTTCATTGATAATGAGA
TGATCGTCATTCTGGGCCAGATGGACAGCCCCACTGAGAT
CTTTGACCATGTTTACCTGGGTTCAGAGTGGAATGCCTCT
AACCTTGAGGAACTCCAGAACAGCGGGGTTCGCTACATCC
TGAATGTGACGCGAGAGATTGATAATTTCTTCCCCGGGCT
ATTTGAGTACCACAACATACGAGTCTATGACGAGGAGGCC
ACAAACCTCCTGGAGTATTGGAACGACACCTACAAGTTCA
TTTCAAAAGCCAAGAAAGCAGGGGTGAAGTGTCTAGTGCA
CTGTAAGATGGGAGTGAGTCGTTCTGCTTCCACCGTGATT
GCTTACGCTATGAAGGAGTATGGCTGGGACCTGGATAGAG
CCTTTGACCATGTGAAGGAACGGCGCTCTGTCACCAAACC
AAACCCGTCTTTCATGAAGCAGCTGGAAGAGTACCAGGGT
ATCCTGCTTGCCAGCAAACAGAGGCATAACAAGTTGTGGC
GTTCCCACTCAGACACTGACCTCTCGGATGGTCACGAGCC
ACTGTGCAAGACCCCTCGCTCACTGGACCGCTCAGATCCT
CACAACAACAATGGTTCTCTTTCTATCCAGCAGATGCTGG
GCATTGCTGTGCTCGAATCCCTTACCAATCCCCGACCTGT
TGCATGCAACACCCATAAAAAATCGGGTGAGACACCCTCA
AAGCTAGCACATGAGGACCTCTTCCTCCTTCCTCAATCCA
GACAACGAGCTGCCACAGTGGGCTCTAAGCAGAGGAACTC
CACTTTGATCCTTGCGGTGCGAGAGCCTGTTTCTCACCGT
CACCCACCTCCTGCTCTACACGTCCTCGATTCTCCTCTTT
TACCAGAGGAGAGAGGAGGAGACACGACTCCAAACCTCGG
CGCCCAGTCGTCTCACCAAGTGCCTGAGCCAAAAACAGAC
TGTGTTGAGTTGTCCCCCGACTTGCCTGATCAAAATGACT
CTTATCAAGTGTCACAAAGCTTAGAACTGTGTCTGGAAAG
TGCTGTCAGTAAAGATGAAGGGAATCTGCCTTCTTCAAGT
ACGCCTGAGGCTGACAGCCCTTCGGAAGCCCCTGCTGTAC
CAGAGCTGGTCTCCAGTGATGATAACAACAACCCTAATGC
AGCAGATCTAGAAGCGGCAGACGACTGTACGGATGCCAGC
GTGTCTCGCCTCAGCACAGATAGCATTGACTTTTTTAGTG
CTAGAGAAAAGTTCCTCTGCCTATCCCAGGACAATCACCC
TTGCTCACTTTCTGAAACAACTGCAGTGCAGTCACCTCCG
GCCAGATGCACCTCACCCTTGGATCACCCTAGTGAGGAAC
CTGAGGAGGAGTGCCACACCCATTCAGAGGAGCATAGCGA
CGCAGTGCTCCAACCCTCTGCTCATGACAGTACTGTGTCT
GTGCGTCATATAGTTACTGAACTGGAATCCACATCACAAA
CCAGCAGTCCGCCACTGGCACACACCTCACCTCAGACTGC
AACACCAGAGGAGAAGGAGGAGGAGGATGAGGAAGCGGCT
CCGGCTCCTCATTCTCTCTCCGACAGGCCCTCAGGATCCG
TGCGCCGGGTGACTGAGCAGTTGGAGCTTATACTACGTCA
GGGTCAAGAGATTCCTCTCTCTCGTTCACCTCTTCCTTCC
CCATGTTTGGGCTGCACACAGTCTTACTCTGATGAGCCAG
AAGATTCTCCTGCCCTCTCCCAAAAGACTCCACAGGGTAA
AGGAGATGACACCAAAGTGCTTGATGATGAGGACTCTGGT
ATAATCCCCGATCCTTCCTTCTCTGTGTTTCTTGAGGGGA
GTGTTTCATTGGAGGCCGACCAGATCACTTTGAACCCCAC
TCTTGAGCCCAGCTCTTGTTCTTCCTCCCTGTTGTGGCTG
GAAGGAGTAACTGAGCTGGAGACAGATGTAGATGATCCGT
TAAGGCCTCAAGTGCGGCTAGCACGCAGCAGTGAGGATTT
GCAGAAAATCCAGGAGACTCTCAGAGAGCTCCAGGCATTT
TTATATGAAGCTGGGGGACTGGGAGTTAGCACTGGACAGG
TTGAGGAAAACCGGTCGTCTGATGGCAGTGGGGAGCAGCG
GTTTGAACCCAAAGCACCAGCGGTGTGGCAGAGAGCCATG
GAAATTGAGGCCCGCATCAGACAAGCCGGCCTCACTCCTC
CCTCACTCATGAAACGCTCTGCCTCACTTGCTAAATTGGA
CCGGCTAGAGCTGTCTACTAATGATTTGAGCGACTGGGAC
TTCCACCCAGCTTCCACAGGACTTCATCATCCCTCTTCCT
CTGTGTCCACCTTTCACTCCTTGCCACTGACCCACAGCCA
TGATGACGCTCATAAGAAGCAGCGCGTTCTACCTCAGAGC
CCTTCCACCCCTGATTCTGCAGTTCATTTGATGGATGCAG
ACAGGACTGAAGGCTCCGCCCACCTTTTACCCTCATGTCC
ACAGAAAACCCAAGTGGGCGGAGCCAGCTCCCCTGAACAC
GTCCCCATTCAATCCACTGTTTCCGTGTCTACACGGCAAC
AGCAGCATGTGAAGACTCATCCCGTTCGCCGCTTGCGGAA
AGCAGTGGACAAGAAAAAGACAGTCACTGTTTTGTACAAC
ACCATGTGACCATTACTGAACTTTCATTCGCTGTTTTTGT
CAGCGTACAGAACTGTCTCTGACTGCAATTTAGGTTTTGT
TCAGTGAAGTCTAAGCTACATTAGTGTGCTACTGAAGGTG
TGAGTGAGGTCACGTGTGAGCGAGCGTATGTCAGTTTTCT
GTTCAGAAACTTTCAGGTAGCAACTCAAACAAGGGGGTTG
TTTCTTAACACATGCACTTTACTCTCTTGTTGAACTTTTT
TATTGTTTTATGTTTCGTCTTTTTAGATAGCATTTTTATT
TGTGTATTTTGCACTGGCTTGAACGGTAGAGTTGACTGTA
TGTCTGACAGCATGTGGAGTCATGATTCTGTTTGAAACCA
AGGTAAACTTGACAACTTTTTTATCCTGTGCTTTAGCTGT
GACTATTATAAAATAAACTGCACTATTTTATTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations