Transcript

abhd15a-201

ID
ZDB-TSCRIPT-131113-1193
Name
abhd15a-201
Previous Names
  • abhd15a-001
  • dkey-230a20.2-001
  • si:dkey-230a20.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057412 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057412|OTTDARG00000040029|ZDB-GENE-131121-270 abhd15a|OTTDARP00000044997 DKEY-230A20.2-001 LG_ CR942805.8 Danio rerio protein_coding PUTATIVE, 4314 bp
CGCCCAGTTTACTTTTCATACTAATGATTCACACATTTCC
TCTTTCTGTAATGAACAACATCTGTTCAGACACATGTGGT
TTAAGGAAAGATTATAAGACCATTCCGATTTATTACAGCA
TCCGCCTAAATGTATGTTGCAGATGAATAATCTTGTGGAG
AGGGCGTTCCTTCTCTATAACAGAGATGATTCACGGGCTC
GAGCCAGCAGAGTGTGATGCGACTCTGAACTGAAAACTCT
TGACAATCATTCATGACAGCAGCAGTTCTGTGGCAGACCG
CAAAAATGAGCGCAAAAATGGCACATGGGTCTCGCAGGCG
GATGCAGGTGAAGAGTTGACTGCGAAAGACCATCTATTGC
ATAATCAGACGGAGCACAAAGGCAGGCTGCGAGGGCGCTT
CGTTTTGAACTATGGCGGCAACACAACAACACGTTCTTCT
GACATAAATTGTGCAAATCTTGGAGAACAGCAACGGTTTG
TTTTGGATGTGCGGATATATAAAAACCATCCAGCCACAAA
ACTTTGAAGTTTGCATTGGCGCTGCCAGAGGTCGCATTCA
TTTTCAAGCTACTACCTGTACAGTGAGCTCTCAATTAACC
CTAAACTGACTGGCGTATGTCAAGCTGAAGTGCGAGCTTT
GGCTGTTTTTTGTGCAGGGGTTTCAAAAGCCGTTCAAATG
CTGGAATGGATTGGCACGGTTTGTTTTCTGATTTTAATGG
CCATACTCTGGCCAGTGGCGAAGTGTTTTGGGGCGGCGAG
TCACTCCACGTTGCTGCTTCCGCGGCGCGACAGCAAAAGA
CCCGCGGAGAGATGCGATTCCAAACTGGAGGAACAAGGTG
AATCAGCCGCGGTCGCCCTCATATGCAAGCCCTCGGCGTT
GGCGAACTACCTTCTTAAACACTGCATGACTTTTTGCAAG
TCTTTGTCGATACCGTCGTGGAACTGGCGCGTGAGCTCGT
CTTTACAGACAGTTTTCGGCGCTCTGTGGCCGGTGGAGTG
TCCGGTGCATTTTATACGAGATCATCTGCAGCTGAGCGAC
GACGGACTGGTGGCGCTGGACTGGGCTGTCGTTGGTGCAG
CGCATCACAAGAGGCGCAGGACTTCCAGCAATTCCACAAG
TCCAGTTCTGCTCATCATTCCCAACTCTTTTGGGAGAATC
ACCCGGAACGTTCTCAAGCTCTGTGAAGCAGCTCTGAGTC
ACGGTTACCTCCCCGTGATCTTCAACCGCAGGAGCCAGAA
CGGGACGCCGCTCTCTACCATCAGGCTGCAGCAGTTTGGC
GACCCGACTGACCTCCGGGAAGCAGTGCGCTACATACGGT
ACCGGCAGCCGGCGGGTCAGATCTATGCCGTGAGCGAGAG
CACTGGTTCAGGACTCCTGCTGTCCTACTTGGGCGAGTGT
GGCTCTTCTAGTTATGTGACGGCTGCAGCCTGTCTGTCGC
CTATTTTCCGCTGCCAGAGCTGGTTTGAGAGTGGCCCAAG
CTGGCCCTTCCACTGGGCTCTCCTGCTCTACCAAAAGATC
TGCCTCAGCAGGTATAAAACTGTGCTCGGGGAGCTGGTCC
ACATAGACAGCGTGTTCTCTAGCTGCTCTCTGAAGGAGAT
GGAGGAGGCGCTGTTCTGCCATTTTAGCTCAAAAGGGGTC
CCAGTGGAGGGAACGGGGAGCTGGGAGGCATATTGGGAGC
GGAATGACCCTCTGAGGGACATCGATGAAGTTGCCATTCC
TGTGCTGTGCGTGTGCAGTCAGGATGACCCCATACGAGGG
GATCCGAGGACCACGTTGCCCTTAGAGCTTTTTGAGAACA
ACCCTCATTTCTTCCTGCTTTTGACTGCCTGCGGAGGCCA
CTGTGGCTTCTCCACGTCAGACGAGGGTCCTGTCGTCTGG
AGCCACCAGGCCTTGCTGGAGTTTTTTCGAGCCACGACCG
ATTTCTTCGCCGCGGAGGAGCGGGCCAAACTAGCGGCCCG
CAGGAGGGGTCTTAGTGGGGCTGGCAAGACTTTCCGCCAT
CGCAGTGTCAGCACATGCAAAAGACTGCCTGTGTGCTCGC
ATAACATACATGCTATTTACAACTGGCAGAGGTCCTACAC
CAGATGATGATGATGATGATGATGTGCTCGGATGGCCACC
CCATTTGTTTTGCATAATAAAGAGACTGAAATAGCAAACA
GCACTGCCAGAAAAAAAGAAATTCAAAACCATTGTCTGAC
CTGCTGTTCGTCACCGCCAAGAAAACCAGCAGTCCAGACA
ATATATGTCAGTTTACATTTAGAAGTGTTTCGACTTCTGG
ACCACCACTGTCAACAGACAGACAGCAACTGTGTTTGAGA
AACTTTGAAAATCATAGCTAAATTTGGGCATTAGAAAAAG
ATGAGGTTACTGAATCATGGTTTAAATATTTCATATTCAA
TTGAAAAAACAAAAGTAAAACGTTTTAATCAGTATTTTTG
TCAGGATTTTGTACTGTATAAGTCATTTATTATCACACTG
TATGAAATGTATGGTTAAAACAAAAAAGTTTGTTTGTAAT
GAACAGTTTGAATGTATGGGAAAAAATTGAAAGAAAATGT
CATTATTATTATTATTATTATTATTAGATATAACCTAATT
TTATTTTTATTTAATTTTTTTGGCTTTGTAAGATTAATGG
TTCAAACAAACAAAATTACCTTTTCTAGTGAGTGGGAAAT
GTAAAATAAATAGATTAAATTCATTGATAAGCTTACCGAA
TTTAGTTTTTTGGTTCAATAATTTGTGTAAAATCTATGGC
TAAAACAACAACAATAATAAAAGAAATCTCAATTAGTAAT
ATTTGAAACAGATGTACAACAACTGTCTTTGAGAAACTTT
GAAAATCATTGCTAAATTTGAGCATTAAAAAGATGAGGTT
ACTGAATCATGGTTTAAAAACTTCATATTCAACTGAAAAA
AACTAAAATGTTTTAATCTGTTTTTTTTTTTGTCAGGATT
TTGTACTTTATAAGTCATTTATTGTCACACTGAAAGAAAT
GTATGGTTAATTGTATGGATGTATGGGAACAACCTAAAGA
AAATGTTGTTATTATTATATTTTTCTTATTTTTATTGTTG
TTTATTATTAGATATAACCTAATTAGATTTTTTTCACTAA
AACTTTGTTATTTTCTTTTTTGAACCATTCATCAAAAACC
TTCTTACCGATTTTTCTTTTTTGGTTCAATAATTTGTATA
AAGTTTATGGCTAAAACAACAACAATAATAAAAGGAATCT
AAATTAGAAATATCTGGAATCTAAATTAATTCAGTGAGGG
AATGTATTCATTTTATTATTATTTTTCTGCCTCAATAAAT
TTAGTAAGTTTAATGGTTAGAACAAGAAAACTAATGAAAT
CTGTATTAGATATTTGGATATATATTATCTCTATTATTAT
TGTTGTTATTATTTTTGAATTATTTTTTATTTTTCACTCA
CAACATTGTGTAAGATTTATGGTTAAAACAACAAAATAAC
AACTTTTTTTTTTAACTCCTTAAAAAGGGAAAGAAAAAGT
AAAACAGAAAATAAGCCTTAAATCTTGATGTTTTCTGGCA
CTTTTGAATCTCACAATTTTAGTTTAGGTTTTTTGATAAA
AATACTGATTGGAAACATGTTTGCTTTATTGAACTGCAGC
TTATAAGTTAGTCTTAAAGCTGTGTAATCTTTTTTTAAGG
GATCGGTCCAAATGTTTGTTCTGTACCTCATGGATATACT
TAATTACTGTAGTTCATTCCTAAATTTGGAGAATTAGTCT
AAATGGTGGCTTCTCCTTTTGGTACTTCGGATATATCTTT
ACCCGTTTGGGTTAGTACATTCCGTGCGCACGATAATGAA
ACGTGCCATTCTGTCATTTTCTCTGTTTTTCTGCAAGACT
GCTGGTGTATTTAGACAGGTCTCTGCTGTAGGAGACAGTC
AGCACTGCTGGGGTTTCGTTTGACGTCAGTCTGAGGTTTC
AGAGAAAACTGGCCTCACGTTGACATTGGGTGGAGCTGCA
GATTTTCACAACTCCAGCACTGATTTCCCCCCTCACTGTT
TTCTCTCTTTTCTATCTCCATCTTAAAAACGTGTAACATC
TTCCTGGTGTCAAACCTCTCGTTTATATGTTAAATTATCT
CTAAACGTTGGAGCTTTCATTAAAGGTTTAATTTGAACAC
ATTGATGTAAGCGAGTCAGCTTTTTTTGGGGCGTCGGAAT
AATAGATTATGCAACAGACTGCATGAAACAGAGATGAGAT
TTCACTCCCACAAGACGCACAAAAATGAAGCATTTGTTAG
CATGCGCATTTAGTTACAGCCATGATTATGGCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations