ZFIN ID: ZDB-TSCRIPT-131113-1148
Transcript Name: itgae.2-201
Previous Names: itgae.2-001, ch211-24o10.9-001, si:ch211-24o10.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057151 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057151|OTTDARG00000039845|ZDB-GENE-130530-671 itgae.2|OTTDARP00000044816 CH211-24O10.9-001 LG_ BX572630.10 Danio rerio protein_coding NOVEL, 3070 bp
TCTCAAGACCACAACGAGCTGCTTTGTGTCTCGATGTGCC
GATGTGTTTTTTTTAAAGCGGATATTGATTAATTTCACAC
AATGTACAGAAAACTGCTATTTATGATGGTATTGTGCAAT
GCAACCGGGTTTAACGTTCAGATATCTCCACTGAAACATT
TTACCAATGAGGATCCACTCTTTGGCCAAACCATCATTCA
GTCAAAAGATGGGATTTTTGTTCCCTCCCCGATATATGGA
GGCCTTTTTGAGTGTACTCTAGACAATGAATGCTCCAAAG
TAAACATTAGCGATGAGAACCCAAAAGGCATGAGACAAGT
AGCATCAGTGGCTAGCCTGACATCACAAGACCAACATGTT
GTGATGTGTAATCAAGTTAGAACAAAGATCAGAGGAACTG
AGTATTTGAATGGAAATTGCACACTTATGAGTCCTTCTGG
AAAAGTCAAGCTATCTCCTGCTGAATTAGACAACAACATG
GACAACAACAACAACAACAACAACAACAACAAATACAGAG
GTGGAAGGATCGATCAAGTTAAATGGAGGAAGAGAAGAGA
AGCGCAACCGAATCTTGGCGCATTAGAGGAGGAGGAGGAA
GAGGAAGAAGATCCTGGGACAGAGATTGCTTTCGTTCTAG
ATGGTTCTGGCAGCATTCAGTATGATGACTTTGAGAAAGC
GAAAGACTTCATCCACACCACCATGTCCAATTGTAATTTT
GCAATAGTGCAATATGGTAGCTCGATCAGGACTGAACTCT
CGCTTCTAGACAATGAGGATGGTGCCAGATCCCTGCAAAA
GGTCAAACAAATAAAGCAAATTTACAATCTCACAAAGACG
GCCTCTGCCATCAATCACGTCCTCACAGATATCTTCATCC
CTGAGAATGGATCAAAAAATAACTCTGAAAAAATAATAAT
CGTCTTGTCTGATGGAAAGATTCTGGGAGACCCTATGACT
CTTGATGAAGTTTTGAACAAGACCCAAATGAAAGGTGTCA
CTCGCTACTCCATAGGGGTTGGCGATGGCATCCTGAAAAA
CAAGGATGCAATCAAAGAGATGACGCAAATAGCAGATCCT
GGAAAGTATTATAGTGTTTCCAGTTATGGCGCATTAAATG
ATATTCTGTCCTCACTGGAAAGAGGGATAATTGGAACTGA
AGGCACTCAGCATGGATTTAAATTACAGCTCGCTGAAGCT
GGATTCAGCTCCCATCTCTTATACAACGAGCAGAAGGTTG
AAGCACTATTTGGAGCTGTTGGAGCTTATGACTGGAGTGG
TGGGGTCTTTTTGAAATCCGGCAACACGGTTAAATTCTTG
AATGATTCTCACAATGAAACCAAATTTGGATATTTAGGTT
ACAGTGTCACTTCAGCTCATTTGCCCTCTAAGACTCTCTA
CATTTCTGGTGCACCACGGTATAATTTGACTGGTGCAGTA
TTCATATTTGATGGCTTAGAAAAGTATGTGCTTCACGGAG
ATCAGGTTGGATCTTACTTTGGATCGGTTCTTTGTGCCTT
GGATATTAATAAGGATGAACACACAGATCATCTATTAGTT
GGAGCTCCACATTTCCATCTGAATGGGGAAGAAGGCAAAG
TGCTAGTGTACAAACTGAATCAAGAGGACAGGTTTGAACG
TGCGCCCGTGGAGCTGCGGGGTGATGCAGGACAGACCTTT
GCCAGGTTTGGTGCAGCCATTGGCTCTATTGGAGACATTG
ATAACAACAAGTTTAATGATGTAGCAGTAGGTGCTCCTCT
GGAAACAGGCTCAGCTGGAAGCGTTTACATCTACAGTGGT
TTCGAAGAAGGTCTTCGCTTTTCACAAAAAATCTCACCAT
CAGATTTTGGAATGAAACTTGTGTACTTTGGTCAGTCAGT
AAGTGTGGGACCTGCACCGGCATCAGATATTCCCTGCATC
GCTGTTGGAAGTCTAGGGAGAGTGTCTGTTTTTGAAACTA
TCCCAGTCTTGATTATCGAACCAACTATCAAAATTGATAC
AGAAGTCATTGCTCTCACTCACCAGATGAATAAAATATCC
AGCGAGTTAAGCATGAAGATTACTGTTTGCTTTAACATAA
AAAAAGGAAAGCTTAAGGCTGAAAAATCTGAAACACAGGC
TGTTGACTATGAAATTGACTTGGATTCTGGTGCAAGCAAA
AAGCGCCTCACTTGCGGCGCAGACAGCCTAATAAAAGACA
CTTTTACTCTGACACCAGATGAAGAGTGCACTAATAAGAA
GCTAACATATTTGGGCTGCTTTGATTGTTTTTCACCTATT
AAAATCAAGCTGAGTTTTTCATTGGCATCCAACAAAAATG
AAGCACCTATTCGCATTCTTGATGCATTTACTCCAACAGA
GGTTGTAAAAGAGATTCCATTTGAAAAGGACTGCCAGGCT
GCAGATTGTAAACCTAGCATTACATTATCTGATTCAAAAA
TAAGTGAAACCACTATCACAATGGGAGAAACGCAAAACCT
GAATATCAATTTCAATTTCACCAACACTGGAGACCCTTCC
TACAAGACCACCCTGACGTTGACGTACCCCAGCATACTCA
GTGAGAGGAAAATTGAAGGAGCCGCCTGTCCTGTGAAGAA
TGACAATCAGATTCAGTGTCATCTTCAACACCCGGTTTTC
ACAAGATCTGCACAGACCAATCTCTTCATCTCCTGGCAAC
TTAATGACAAATCTGATCTCAAGAAGTCTGAGATTATAGC
AAATCTTACCAGTCAGAATAATGGCATTCAGCTTCTGGAC
TCTAGAATATATACGTTTAATGTGATGTATTTCCTACCAA
TTCTTATACGTGGCTCAGCCGAACCTAACATACTCCGTAT
TGAAGAAGGGGGAAAAGGAAAAACTCAGCCAATCAAGTTT
AAAATTCAAGTACTTTAAACTTCACTTTGAACTAGCCGTC
TGATATTTATTTTTACCATACTTAAATTGCATTGTATTCT
AATTCAGTTTCAAGGTGAAAATAAGTATGGCGCTACAATT
GATGTAATTATAACTATCAAAATGGATACCTCTAAAACTG
ATCTACACATCACCAAAATCCAACCAGAGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itgae.2-201 Contained in:
[BAC] CH211-24O10 (1)

Genome Resources: Vega_Trans:OTTDART00000057151 (1),  Ensembl_Trans:ENSDART00000154801 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DV598570 (1) 814 nt
GenBank:DV594652 (1) 732 nt
CITATIONS (2)