ZFIN ID: ZDB-TSCRIPT-131113-1135
Transcript Name: proca1-201
Previous Names: dkey-81n5.5-001, proca1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057107 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057107|OTTDARG00000039822|ZDB-GENE-110418-1 proca1|OTTDARP00000044784 DKEY-81N5.5-001 LG_ CR855391.6 Danio rerio protein_coding KNOWN, 3254 bp
CATTTGGAAATCACTGCACATTGTTCACTTGCCATAAAGA
CGCCAGGAGGAGGAAACAGATGCACAAGGGGTATTCAAGT
TCACTGGAGGAGGAAAGAGTTAATTAAATGACAGACCCCT
CCCATTATTGACTGGCAATATATTAATAGGCAGTGTGAAA
GAAGCCGGCAGTCGCTGGTCAGGACTCAGGAGAGCTTGCG
GTGCTGTCTGACGCTCTGTGGTGCTGAAAGTGCCGCCCGC
CGCGATGTGGTCCGTGTTTTTCGTTTTTCTGTCTTATCTA
GACAGAAACTTTGTTAAAGGAGAGTTCTTGAGCCAGACTT
TAGATGCCGAAAAGGAGAGCAAGGAGCTCTTTTACATGCT
CAACAACACTCTTTGCGCCAAAAGTTCAGTTGTAGGAGAG
TACCACCTCCATCAGGTCACCGATGGGGCAGAAGAGGTCC
GCTCTGTGCATGACTCCGAGGGGCGCCTGCTCGACTGCTC
AGTCATCCAAAACCAAATGCAGGTCAAATCCTTTATGCAT
GTCTGCAGACTTGGCCTAAGAAACCAAATGAGCTCCGACC
TGAAGATGAGCTTGACTGGGGTGTCCGAAGCGAAGGCGAA
CTGTAACAAGCTGAGATCAAAAGGAGCCAAGAATGTGATA
CCGACGACAAAACAAGTGAAAGAGGCGAGCAACAAGAAGA
CGCGAACCAAGCGAGGCTTCACTTATCCTGGCACTCTTTG
GTGTGGTGCTGGAAACATCGCAGATCATTATGAGCAGCTG
GGCGAGTTCGAAGAGACTGACAGATGTTGCCGCGTTCACG
ATCACTGCCCATATGTCATCCATGCGTTCTCCTCCAACTA
TGGATATACCAACTTTAAATGGCACTCACTCAGCCATTGT
GACTGCGACAATGCCTTAAAAGAATGCCTGAGGCTCGTCA
ATGACACCTCCTCCCGAGTGGTTGGACAAGCTTTCTTTAA
TGTGATCGAAGTGCCTTGCTTCGAGTTTTCATTTGAAGAG
CAGTGTGTTGAGCGCCACTGGTATGGTGTGTGTAAAAAGT
ATGAAAGAGTTCCTGTTGCAGTGATTAAAGAATCAATCCC
GTATGACTTCGGGGGTATTGATGTCATTGACGTACTGACT
CTCGCTCCTCTCAAGGGAAAGCAGTCAGACAAAGAGATGC
AGAACAAGACTGAAAGCACAACAGAGTCAACGTTCCCAAA
GACCACGAGTCCCGAGGAGCCCTCGCTTACAAATGTGGTG
ACGGCCGCAGAGGATTTCATTAAAGTGCTCGCCACAGTCT
CCACCTCTCAAAGCTCATCCACAGATGCAGGGAAAGGAGA
AACTCAGACGTCAGAGAAGAAGAAGAAGAAAACCTCTGGC
AAAAAGAAAAAGGAGAACAAGAAGAAAAGGGGCAAGGGTA
AAGGCAGGAAGAAGAATAAAAAACTTGATGCTGTGTTAAA
AGTCGATGAAGGTGCGTCCGGTGCGACAAATCCAAATGAA
GAAGTCATGGGTAAGAACAACTACATGGAGGAAACACCAA
ACACAAATCAATTAAGCGTAAAAGAAAACAATTTCATGAA
CAGCGAGCTAGACGCAGTAGGAAATGGGGCGCTTTCTAAT
AAGATGATGAGGGATGATCCTCAAAGGTCGAATGATAATC
GGGATGCTGATCAATCCTTAGTGAAGACTGGTAAAGATCC
AGAGATTCTTGAGTACAGGCAAGTAAATGACACTGAGTTG
GTTTCTCCCTCACCTAGAGATCACATTACCCCCGCCAGCC
GTGAAAAGAACAGAGCCAAGCTAAGACAAAGAGGCGGAAA
GAAAAAGCAAAGAAAAAACAATCCTTCCACAGAAGTTTCC
CAAGCTTATTTCAAAGAAGAAACACTTTCAGTAAGTGCGC
CCGAAGGTGCTAGCCTTGCAACATCAACCACAGAGAGCCC
CATTACACTGGAGGTGACACAAAGTACACAGTACACGGAC
GAAAAGGGACTAGTAGGAACACCTGTTAAATCCAAAACAC
CAAGGCAGAGAGAGGGAAGAAAGAGACAAAGGAAAGTCAT
TGCTTCCTCTAACGAAGAACTCCCTCGTGAATCTACCTCT
GAAGACCCTCTATTGTCCACAAGCACTGTTGAACCGACTG
ACTTGCAAGAGAGACTGGGATTGGACAATCTTGAAAATGC
ACAACAGAGTTCGAAGGACATCAAGCGAGGGCGGCGTGTC
ATCAAAATCTGCTACGAAGCCGTTTTGCCTGATGTTGCAG
ACACGACACCCCTGCCGACACTAATCGAAAAGGACAATGA
GTTTCAGTTAAAGGACCCGGAGGTACATACAGTGATTCCT
AATCTACAGACTAACACTCCGTCCATGCCTCCCCGCAGAC
TTGGAAAGACCAAAGTGAAGAGAAGCAGAGAGAGAGGAGC
AGGAGAAAAGCATGGAAAAGTTAAGAGAGAGTGAAGATCA
CCTCATCTTCTAGGACAGTGTTTCTCAAGCACGTTCCTGG
AGGGCCACCAACTCTGTATGTTTTGCATGCCTCCTTTCTC
TGTCACACCTCTTAAAGGTTTTTCAGTCTCGACTACTGAG
CTGAAGATCTGAATCAGGTGTGTTTGGTTAAGGAGACACA
GAAAATGTGCAGAGCTGGTGGTCCTCCAGGAACATGGTTG
GAACATGGAACATGGTTGATCCGAAACACTGTCATCCGAT
ATGATGTTTTTAATAAACTGCATGTTTTTATCTTCTGTTT
TTATAGCTCTGCTGATGCTAAACTGACAAATCAGATCAAT
TCTTGAGAAGCATTTGTTTCTCGACATGATTGCCGAATAA
AGTAAATATGAGCACTGGTGGTTCTCCTAAAGTGTGGTTT
AAGAAAACATTCCTCCGCTACACAATACGGGTTTTGTTTT
TTAATAGTTTTGAGTGTATTTCCAGGTAACCTGATTATTT
GCCCTCCTTGAAAAAAAACGAACCCAAGTACCTGCAGAAC
ATTTATGACAGTCTTTGTTCTAGAGCAGACTTTGTCCTTC
CTAGGCCTGTGCCAATGGACTTAAGCAGAAAGGGTCACAT
TCTTCTCAAAGGATAATCTGGTTTAGGTGCCTCTCCCACC
CTCCAACTTTAAATCAGTATTGAAATGCTGAACTCAAATC
TCCCATCAGCTGATCCTCACATGCTCCTTTTGGAAAGTGA
GCCAGAATTGTCTGCAGAGGACGATGTACATAATTAAAGT
CGCAGTGTTACAGTGATGCAAGCTGGTTTCAGATGTTCAT
TCGTTTTTTTTTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
proca1-201 Contained in:
[BAC] DKEY-81N5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057107 (1),  Ensembl_Trans:ENSDART00000101918 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN507940 (1) 939 nt
GenBank:CO393800 (1) 894 nt
GenBank:DV594156 (1) 850 nt
GenBank:AL726056 (1) 617 nt
GenBank:AL925605 (1) 539 nt
CITATIONS (2)