Transcript

proca1-201

ID
ZDB-TSCRIPT-131113-1135
Name
proca1-201
Previous Names
  • dkey-81n5.5-001
  • proca1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057107 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057107|OTTDARG00000039822|ZDB-GENE-110418-1 proca1|OTTDARP00000044784 DKEY-81N5.5-001 LG_ CR855391.6 Danio rerio protein_coding KNOWN, 3254 bp
CATTTGGAAATCACTGCACATTGTTCACTTGCCATAAAGA
CGCCAGGAGGAGGAAACAGATGCACAAGGGGTATTCAAGT
TCACTGGAGGAGGAAAGAGTTAATTAAATGACAGACCCCT
CCCATTATTGACTGGCAATATATTAATAGGCAGTGTGAAA
GAAGCCGGCAGTCGCTGGTCAGGACTCAGGAGAGCTTGCG
GTGCTGTCTGACGCTCTGTGGTGCTGAAAGTGCCGCCCGC
CGCGATGTGGTCCGTGTTTTTCGTTTTTCTGTCTTATCTA
GACAGAAACTTTGTTAAAGGAGAGTTCTTGAGCCAGACTT
TAGATGCCGAAAAGGAGAGCAAGGAGCTCTTTTACATGCT
CAACAACACTCTTTGCGCCAAAAGTTCAGTTGTAGGAGAG
TACCACCTCCATCAGGTCACCGATGGGGCAGAAGAGGTCC
GCTCTGTGCATGACTCCGAGGGGCGCCTGCTCGACTGCTC
AGTCATCCAAAACCAAATGCAGGTCAAATCCTTTATGCAT
GTCTGCAGACTTGGCCTAAGAAACCAAATGAGCTCCGACC
TGAAGATGAGCTTGACTGGGGTGTCCGAAGCGAAGGCGAA
CTGTAACAAGCTGAGATCAAAAGGAGCCAAGAATGTGATA
CCGACGACAAAACAAGTGAAAGAGGCGAGCAACAAGAAGA
CGCGAACCAAGCGAGGCTTCACTTATCCTGGCACTCTTTG
GTGTGGTGCTGGAAACATCGCAGATCATTATGAGCAGCTG
GGCGAGTTCGAAGAGACTGACAGATGTTGCCGCGTTCACG
ATCACTGCCCATATGTCATCCATGCGTTCTCCTCCAACTA
TGGATATACCAACTTTAAATGGCACTCACTCAGCCATTGT
GACTGCGACAATGCCTTAAAAGAATGCCTGAGGCTCGTCA
ATGACACCTCCTCCCGAGTGGTTGGACAAGCTTTCTTTAA
TGTGATCGAAGTGCCTTGCTTCGAGTTTTCATTTGAAGAG
CAGTGTGTTGAGCGCCACTGGTATGGTGTGTGTAAAAAGT
ATGAAAGAGTTCCTGTTGCAGTGATTAAAGAATCAATCCC
GTATGACTTCGGGGGTATTGATGTCATTGACGTACTGACT
CTCGCTCCTCTCAAGGGAAAGCAGTCAGACAAAGAGATGC
AGAACAAGACTGAAAGCACAACAGAGTCAACGTTCCCAAA
GACCACGAGTCCCGAGGAGCCCTCGCTTACAAATGTGGTG
ACGGCCGCAGAGGATTTCATTAAAGTGCTCGCCACAGTCT
CCACCTCTCAAAGCTCATCCACAGATGCAGGGAAAGGAGA
AACTCAGACGTCAGAGAAGAAGAAGAAGAAAACCTCTGGC
AAAAAGAAAAAGGAGAACAAGAAGAAAAGGGGCAAGGGTA
AAGGCAGGAAGAAGAATAAAAAACTTGATGCTGTGTTAAA
AGTCGATGAAGGTGCGTCCGGTGCGACAAATCCAAATGAA
GAAGTCATGGGTAAGAACAACTACATGGAGGAAACACCAA
ACACAAATCAATTAAGCGTAAAAGAAAACAATTTCATGAA
CAGCGAGCTAGACGCAGTAGGAAATGGGGCGCTTTCTAAT
AAGATGATGAGGGATGATCCTCAAAGGTCGAATGATAATC
GGGATGCTGATCAATCCTTAGTGAAGACTGGTAAAGATCC
AGAGATTCTTGAGTACAGGCAAGTAAATGACACTGAGTTG
GTTTCTCCCTCACCTAGAGATCACATTACCCCCGCCAGCC
GTGAAAAGAACAGAGCCAAGCTAAGACAAAGAGGCGGAAA
GAAAAAGCAAAGAAAAAACAATCCTTCCACAGAAGTTTCC
CAAGCTTATTTCAAAGAAGAAACACTTTCAGTAAGTGCGC
CCGAAGGTGCTAGCCTTGCAACATCAACCACAGAGAGCCC
CATTACACTGGAGGTGACACAAAGTACACAGTACACGGAC
GAAAAGGGACTAGTAGGAACACCTGTTAAATCCAAAACAC
CAAGGCAGAGAGAGGGAAGAAAGAGACAAAGGAAAGTCAT
TGCTTCCTCTAACGAAGAACTCCCTCGTGAATCTACCTCT
GAAGACCCTCTATTGTCCACAAGCACTGTTGAACCGACTG
ACTTGCAAGAGAGACTGGGATTGGACAATCTTGAAAATGC
ACAACAGAGTTCGAAGGACATCAAGCGAGGGCGGCGTGTC
ATCAAAATCTGCTACGAAGCCGTTTTGCCTGATGTTGCAG
ACACGACACCCCTGCCGACACTAATCGAAAAGGACAATGA
GTTTCAGTTAAAGGACCCGGAGGTACATACAGTGATTCCT
AATCTACAGACTAACACTCCGTCCATGCCTCCCCGCAGAC
TTGGAAAGACCAAAGTGAAGAGAAGCAGAGAGAGAGGAGC
AGGAGAAAAGCATGGAAAAGTTAAGAGAGAGTGAAGATCA
CCTCATCTTCTAGGACAGTGTTTCTCAAGCACGTTCCTGG
AGGGCCACCAACTCTGTATGTTTTGCATGCCTCCTTTCTC
TGTCACACCTCTTAAAGGTTTTTCAGTCTCGACTACTGAG
CTGAAGATCTGAATCAGGTGTGTTTGGTTAAGGAGACACA
GAAAATGTGCAGAGCTGGTGGTCCTCCAGGAACATGGTTG
GAACATGGAACATGGTTGATCCGAAACACTGTCATCCGAT
ATGATGTTTTTAATAAACTGCATGTTTTTATCTTCTGTTT
TTATAGCTCTGCTGATGCTAAACTGACAAATCAGATCAAT
TCTTGAGAAGCATTTGTTTCTCGACATGATTGCCGAATAA
AGTAAATATGAGCACTGGTGGTTCTCCTAAAGTGTGGTTT
AAGAAAACATTCCTCCGCTACACAATACGGGTTTTGTTTT
TTAATAGTTTTGAGTGTATTTCCAGGTAACCTGATTATTT
GCCCTCCTTGAAAAAAAACGAACCCAAGTACCTGCAGAAC
ATTTATGACAGTCTTTGTTCTAGAGCAGACTTTGTCCTTC
CTAGGCCTGTGCCAATGGACTTAAGCAGAAAGGGTCACAT
TCTTCTCAAAGGATAATCTGGTTTAGGTGCCTCTCCCACC
CTCCAACTTTAAATCAGTATTGAAATGCTGAACTCAAATC
TCCCATCAGCTGATCCTCACATGCTCCTTTTGGAAAGTGA
GCCAGAATTGTCTGCAGAGGACGATGTACATAATTAAAGT
CGCAGTGTTACAGTGATGCAAGCTGGTTTCAGATGTTCAT
TCGTTTTTTTTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations