ZFIN ID: ZDB-TSCRIPT-131113-1099
Transcript Name: dnajc30b-201
Previous Names: dnajc30b-001, ch211-235m3.11-001, si:ch211-235m3.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056982 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056982|OTTDARG00000039733|ZDB-GENE-131121-532 dnajc30b|OTTDARP00000044708 CH211-235M3.11-001 LG_ CR382327.27 Danio rerio protein_coding PUTATIVE, 1682 bp
CCTGTGTATTGCCGGATGCAGGTTCTGGTGTGTCCGTGGT
AATGGCGGAGGTCACCGGCAGTGTGAGGAATGCAGTAAAC
AAGCTATCTGCCTTCAAAACGTTATTAAGTCTTCATCATC
ATCCTCATGGTCCTGTGGTGGATTCCCGCGCGTTGTGCCG
TAAATCTAACGTGTGTGTCCACTGGTGTGCTGCTGACTGT
GTGTGGGCGCTTCATAATAAACACGCACAGCTCTACAGAC
CCCAGATCAGTGGATGCTACACCCTTGTGTCTGCTAAACA
CTGGTGTCTGCTGTTAAGACCGGTGGGATCACGGTTATAC
AGCTGCAGGACAGCAGATGAGAGCTCTGGGCTGCTCCACC
GCAGCCGCACCGCCTACTATGACATCCTGAAAGTGTCTCC
GAACGCGACGCATGCGCAGATAAAGAGCGCCTATTATAAG
CAGTCCTTCATTTACCACCCTGACCGGAACCGCAGTGAGG
ACGCGGCACGACAGTTCGCACTCGTAGCCGAAGCCTACAA
TGTGCTGGGCAGCAGCAGTCTCAGGAGGAGATACGACCGA
GGCATCTTGACCCAGAAAGAGGTGCAGAGCTCAGGCAGAC
CTGCGGCTCCTCCGCCCCCCCGCCGCGCTCCGGCCTCCGG
GAAAACGGCACACTTTGACTTTGACGCGTTTTACCAGGCG
CATTACGGAGAGCAGCTGCAGAGAGAGAAACTGCAGAGAC
TCCGACAGCAGCAGATCCAGCAGCGGCGCATGGAGATGCA
GAAACAGTGGAGACGGGAGCAAATCACCGGAGTCTCCGTT
ATACTGCTGCTGCTGCTCGGAGGCGTCATCATCAACAGCC
TCAAATCATGAGTCAGGGAATGTTTGGGGAGATTAAACCT
TAAATGCATTAGAAAGTTTAAAGTGGTCATGTGGGGATAG
CTCACCCAAAAATAAAATAAAAATTCTGCCATCATCAGAT
TATATTTGAGTTGAACACAAAGGAAGATGACCTGAAGAAT
GCTGGAGAATAAATTCAGCCACTGACTTCCAGAGTATTTT
GTTGTTCCTATTATGGATATCAACAGCTGTTTTTTCCCCA
GCATTCTTCAGAATATCTTGCCTTGTGTTCAATAAAAGTT
TTGACACACCTGAGGGTGAGTAAATAATTAAGACATTTTT
ATTTTGGGGTGAACTGTACCTTTAATCATGGCAGAGTCTG
TTTCCTATGGAAGCTTGTTCACAGAATAAAATATATATAT
ATATATTTAAAAACAAATGTAATTCAGTCTTTCTGGATAC
ATGTCTTACTTTAAAAAAGTGTAAACTATCTAACTTATGT
TTATTTACAAAGATACTATCACTGGTTTTCCGCACATGTA
ACCCCACCAATCCTATACCGACCAACCCGCTTTGAGCTGG
GATTGAACCGGCGATTCTCCACATGGGAGTCGGTTGCACT
AACAAGGAGGCTAAAGACCACAGCCCTTAGCCTCTGTCGC
TAGAGCACCTTCAGAGTTTAGATGAGTCAGGTTTACCTGC
ACAGCACTTCACTAGCTGGCCTCTGCTACACACTTAATAA
ATAATAATGAAGGGAAATGACGCAGCACAACACCAGCAGG
GGTCACTCTTACATCATTACACTAGTAATACAGTTTTTTG
TTGTTGTTTACACACAATTATTTGCACTTTAGACCAGGGG
CG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajc30b-201 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000056982 (1),  Ensembl_Trans:ENSDART00000114923 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH594203 (1) 927 nt
GenBank:BQ260883 (1) 564 nt
CITATIONS (2)