ZFIN ID: ZDB-TSCRIPT-131113-1097
Transcript Name: si:ch211-235m3.5-201
Previous Names: ch211-235m3.5-001, si:ch211-235m3.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056976 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056976|OTTDARG00000039727|ZDB-GENE-131121-233 si:ch211-235m3.5|OTTDARP00000044706 CH211-235M3.5-001 LG_ CR382327.27 Danio rerio protein_coding NOVEL, 1913 bp
TACACGACGTCTAGTAAACGATTAACCCGAAGAATCACCT
GAAAGTAAGACGCAAGCCCAGCCCACTGCATTTCCCATCC
CCATTATCTGCCTTCAAACTAAACCAGTGACAACAACTCG
ACGACTCGCTTTCACAGGCATACATGAAGACCCGAGGCTC
TTTTTAAATCTCTTCGCACTGGAGCTCCATCAGCTATTAA
AATGGAAGTGAGCGAGGATTTCTACATGTTTGAGTTCAGC
AATGCTGAAGATGATGCGCCGGTTTATCAGGACTCTGAGG
ACTTGTTTGCGGCTCTTCGGCAAAAGGAGGATGAAGTTAT
ACTCGCTGCTCAGGTGGGAAATGCTTTGCTCATGGAAAAC
AGACAGATGAAGGAAGAAAGGGACACTTTTCTGGAAAAAT
ACACACAGCAGATTGAGGAGCTCCAGCAGAGCAGGTACGA
GCTGCAGGTGAAGCTGGAGAACTGCCAGGCTCAGTGGGAG
GGTCAGGTGTCGGAGCTGGAGCGAGACGTGCAGGAACTGC
AAGCGCAGGTGGAGGAAATGAAGCAAAGTCTCCATGAGGC
TGAAATAGAGAAGAGCAGACTGAAGCAAGAGCACGGCGAA
CAGTGCCAGAGACTCAGACAGCAACTGCAGAGGGGAATAG
AGGTGGAGCGAGCCATGACCGGCGAACTGCAAAGACTGAA
GCAGGAAATGAGAGAAAGAGGACAGGCCAGACCTCAAGAT
GAAGAGATGATCAATGCTCTTAGAGAACAGGTTGCACGAC
TCACACAGAGAGAGCAAACACTGGAGCAGCGCTTGAAAAT
GTCCTGTCATGAGAATGAAGAACTGAGAGACACGGTGTCC
TCACTATACACACGCCTGGATCTGCAGGAACAACAGACTC
ACAAACACACACAACAGCTGGCAGAGGCCTGGCAGGAAGT
TGACAGGGTTCGTTTCTGGGCACAAGATCTGCAGAGTCAG
GTAGTGGAGCTCCAGGATGAAGTGGCGCTCCAGGAGAAGA
GTCACAGTGACACATCTTTACTGTCCGAACTCGAAAACAA
CCTGGACGTCACAAACTGGAGCCTGAACACAGAGCAGATC
TCTCAGGAGGTGCACCACATCCTGGAACTGCTTCAACCTG
TAATCTGCGGCTCAGTAGCTGAACGGGACTCAGATGACAG
CCTGCAGGGCATGATGGGACAGTTGAAACATGCTGCAGAA
TGGATAGCACAGAGTCAAACACAACAGAACGAGAGTCTTT
TAGCAGAAAACGCCAAACTCAAGCTGCAAACCGAGAGACT
TCTGGATGAGGAGGTGGTCCAGCAGGCCTTAAAGGACCGC
GATCATGCCTTTGCAAAGAAGACAGCGATGGAAGCAGAGC
TGCTGAAGACTAAACAAGATATGATGTGCTTAAACAACCA
ACTCCTGGAAGCCATCCAGCGAAAACTTGAGCTCTCGCAG
GAACTCGAAGCCTGGAAGGACGATATGCAAGTTATCATCA
ACCAACAGCTCAGGAGCCAACAGGAAACAGAACAGCAGCA
ACGGAAGTCATCTGTCGGTCGTCTTTCTTTCCTGCACAAA
TCCAGACGGCCTTCATCTTCGCCGTCCACGTTTTCAGAGA
TCAGTTCAGTGCAAAACCACTCGCCTTGGAGAGACTGGCT
CAAAATCAACAAATAAACCTGTTGCACGATCTCACCAGCA
GATCCCCTGCCAAACTGAGACCTTATTAGATCAGTGTTGA
GTTAACGAACAACTCTAATGTAAAAGACTCTTCCATAATA
GACATTTACATCTCACATTGGAATTGCTCCTGCCAAAAGT
TACGTCTTGACATTCAGTACAATCGAACACCTTACTAATG
ACGTACAACTGTAATGAATCCTGATCAATTTCATGTAAAG
AGGTGGTCCACTACAATATCGTATGGTAAACTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-235m3.5-201 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000056976 (1),  Ensembl_Trans:ENSDART00000108856 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)