Transcript

pamr1-202

ID
ZDB-TSCRIPT-131113-1057
Name
pamr1-202
Previous Names
  • pamr1-001
  • dkey-234i14.19-001
  • si:dkey-234i14.19-001
Transcript Type
mRNA
Annotation Status
Annotation Method
Havana
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056845 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056845|OTTDARG00000039627|ZDB-GENE-100422-12 pamr1|OTTDARP00000044596 DKEY-234I14.19-001 LG_ CU207301.28 Danio rerio protein_coding NOVEL, 4751 bp
GTGTGTGTGTGTGTGTCAGACTACAGGTTTGTGCCGAGCT
GGTGTCCGGGGCCGGAGTGGAGTGTGTTGTGTCGGGGCTG
CTGTGAGTATGATGTGATCCGCTGTAAGTGCCCTCTGCAG
GGGGCGCCGGTGGGCTACGCTGTGCCCTGCTGCCGCAACG
CTGCCGATGAGTGTGACCCCTGCACCATACACCCCGGCTG
CAGCATCTTCGAGAACTGCAAGCGCTGTAATAACGGCACC
TGGGCCCCGAGGGACGACTTCTTCCTGAAGGGTCAGTACT
GCGCCGAGTGCCGGCCGGGGTGGTCTGGAGGAGACTGCAT
GACGTGTGGAGGGCTGATCCACAAGCGGCAGGGGCACCTG
GTGTTGGAGAGTTACCCGAACAACGCCCGCTGTGAATGGA
CACTGAGAGTCGACCGACCATACACTATTGACCTCAGGTT
CATGATGCTCAGTCTGGAGTTTGACCACAGCTGTCAGTAC
GACTATGTGGAGGTGAGGGACGGAGACAGCCTGAACTCTC
GCCTGATTGGTCGATACTGTGGAAACGAGCGGCCTCCTCC
AATCAGGAGCTCTGGGAGTTCCCTGCACCTGCTGTTCGTC
TCAGATGGATATAAACACTTCGATGGGTTGTTTGCCATCT
TCCAGGAGAGCTCAGAGTGCATATCCTCTCCGTGTCTGCA
TGACGGCACCTGTGTGGTGGACTCCTCGCGCTCCTACCAC
TGCGCCTGCCTGGCCGGGTACACCGGAAAGAGGTGTGAAC
ATGTGCTGGAGTGCAGAAGGCCTTTGATTCCAGCTCACGG
CTCTATGAGGCATCTGGACGAGCGGGTCGGAGGTCATGTT
GTGTTCCAGTGTGAACCGGGACACACTTTAAAGGGTTTCC
GCATTTCCACCTGTCTGCTGGACGGCTCATGGAGCTCGCC
AACTCCACAGTGTGTGCCTTTCCAAAACTGCGGCATTCCT
CCAAAGCCAGAGAACGGAGACCACTTCCTGGTTTATGGAC
CAAACGATGTGCTTATTGCTATACAGTATTTCTGCTATAA
GCAGTATAAGCTGAAGGGAGCCCCTCAGAGAACTTGCCTG
GGAAACAACACCTGGAGCGGGACGGCACCAACCTGCATCA
CAGAGCCGGATGTGATTCCTACAGCAGATCATGAGCAAGA
CAAAGGCAAAGTCAAACCCTCTGGAGCAGACGATGTGGGC
GATGCCAAGAACAAAACCTCACAGGAAGAAGAAAACGAGT
CCAAACCAGATAAAGATATCAAAGCACAGAAGCCCACCGC
AGGAAAGGGCTACGATCTAGTGTTGGGAAAAGACGTGGAG
AAAGAAATCGTCAGTATATTTGTGAAAGAAAAGCCTAAAG
CTGAATATAAGGAGAGCGACAGCAGCATCAACACCATTGA
AAAGAAAGATCCTGGAGAGGATAAAGACACTCTTAAAGTC
CTCGGTAAAGATGAACATCTCCACATCGAAGAGAAAGTCG
TAACTCCAAGCAGAGATGTGGAATTAGTAGATATTGTGTT
GATAGACAATCAGATGGAGAACAAAACCACAGATGATAAC
ACAGGGAGAGAATATACAATATCCAGACTGAATGAAGACA
GGAAAGAAAACCTTCTCAATGAAGTAGACGTCACACAGCA
AGAGAATAACACTGGATTCTTCGACAGCAATGACATCGAT
GAAAATGCAGACACGCCGCGGCTGAAGCAAACTGAAGAAC
CTCCATCACCCACTGCTGTTCACTACAGCACAGAAACCAC
AACCACAGCCAGCAGAAGCACAGCGAGAGCCGCGGTTAAA
CCTGCTCTTCAGGAGGATCCACAACATGTAGAGACAGCAG
ATGTACAGCAAGAACCCACAGCAGAGTCTCCGCCAACCGC
ACAGAATGAAGCAGGTGAAGTGACTCCGTGTCCTCCACCG
CCTCCGCTGTATCACGGTTTCTCTGAGCGAGTGTCTGGTG
TGCGTCCTGAAACTCTGCGCTTCTTCTGTAATCAGTCGTA
CGCTCTGGTCGGCAGCGACCGCAGAACCTGTCAGGCTGAC
GGCAGCTGGTCTGGAGCTCAACCCGTCTGCATTAGAGCTT
GTCGAGAGCCGAAAGTCTCTGTTCTGGTCAGACAGAAAGT
TCTTCCTCCTCACGTCCCGTCCAGGAAGACTCCAGTGCAC
AAGTTTTACTCTTCCTCCGTGTCGACTGTCTTCCTGAAGG
ATGTGCGTGCGACGCAGAGCCCGCTGAGTTTACCCACGCT
CCCGCAGGGTTTCCACCATCTGTACACACACATCGAGTAC
GAGTGCGCGTCTCAGTATTACCAGCACTCGGGCAGCTCCC
GCAGAACCTGCCTAAAGATGGGCAAGTGGAGCGGACGCCA
CGTCTCCTGCTCTCCAGTGTGTGGGAAGCTATCGTCCTTC
GACCCTCAGAAACCGGAGCAGACGCAGTGGCCTTGGCTAG
CCTCCATCTACAGACGTCCAGCAGGGAAGCTGAAGCTGAA
GAGCGGGAAGGAGGATCAGGCGGAGGATCAGGCGGAGGAC
GGGTGGCAGCTGGTCTGCAGTGGAGCTCTGGTCAACCAGC
GCAGTGTGGTGGTCGCTGCTCACTGCGTCACGGAACTGGG
GAAAACACACCCGCTGGACCCACACACACTCAGAGTCACG
CTGGGGAAACACTACCGCAGCGAGCGCAGACACACTAAAG
GCCTGCAGACTGTACGGGTTTCCTCCATCGCTCTGCATCC
GACCTTCGACCCTCTGGTCCTGGACTCAGACGTTGCGGTG
CTGAAGCTGCTGGATAAGGCTCGTATCGGAGAGCACGTGG
TGCCGGTGTGCCTGCCGGACCCTCAGCTGACTGCAGACCA
GGGTTTGGTGACCGGCTGGTCTCTGGAACCAGATCCCGCG
GATGCAGACGGGGAGCGGGCGCGGGTGGGTCACGTGTTGA
TGGGGGATACGGTGCAGTGTGAGCAGCAGTACGCCAGCCA
CGGCCTGCCCATCAGTGTGTCTGAAAACATGCTGTGCGGA
CGGCAAGCGGAGCGCTCCAACATCTGCCCTGCCGACACCG
GGGGGATCCTGCTGTCCCCGGCCGGCTCCGCACACACCCC
GCAGCACTGGACGCTCCTCGGGCTGGTCAGCTTCGGGTTC
GAGTCTTCAGTCTGCAGCTCAGAGCTCTACACCGTCTACA
CACACATTGCCAACTTCGTCAGCTTCATAGAGGCCAACAT
GACATGAAGAGCAGCCGTACTGACACGGTCCAAATCAAAA
TGATCCTGAAAATACATGTAGGAGAATAACTCAACTGTAT
ATAGACTCAAACACACTGGACGGTGCAGTGCACGGATGAT
AATCCCTAAATAATACAAAGGAAATAATCCAGACAGGAGA
TGAACGAGCAGCACTTTCTGTGAGCTGGACATCAGTTTCT
CAGGTTTTATAAAATGAGGCACTTCTAATCTGTAAATGTA
CAGAAGCTGTACTGTTGTATTTACCATTGTTAGTGTTATC
TAAAGGTGTATATATTTACAGTATTATATGTATATTAACA
TGTATATTCAGCGGGGCAATAGGAATCTCAACTCGTGGAC
TGCAGAGACATTCGGTGCATTCCAAACGGGATATATCACC
CTCTGAAGGGCACTTCAGAGTGAACACAGTCACGTCCACC
ATGTTGAAGTGTCCTTCAGGATGAATGATACCCTTCAGTT
CCCTGTGATCCTTTGCACAGGAAATTGTTTTGGTGTCACA
CACTGTTACATTTAGAAGATCTCATCCCTATTCCCTAATC
CTGTCAAAGCAGGTCACTACACCTTCCAAAGGGGTTAGGA
CAGGGTTCACCAATCTCGATCCTGGAGGGCCGGTGTCCCT
GCAGGGTTTAGCTCCAACTTGCCTCAACACACCTGTCTGG
GTGTTTCAAGTATACCTAGTAATACCTTGATTATCTTGTT
CAGGTGTGTTTGATTAGGGTTGAATCTAAACTCTGCAGGA
CACCGGCGCTCCAGGAACAAGTTTTTTGACCCCTGGGTTA
GAGAATAGGGAGGAGCCCTTCCATTTGAAACACAGTGCTT
GAGACCAAACCTCTTTCCAAACGGAACGCAAGATAAAAAC
TGAAGGTAAAATTATAAATAGTATAAATTAAAACTTAAAC
GGGTGGCGCAGTGGTTAGCACTGTTACCTCACAGCAAGAA
GGTCCCAGGTTCAAGCCTTGGCTAGGTCAGTTAGCGTTTC
TGTGTGGAGTTTGCATGTTCTCCACTAAATTGGCTTTAGT
GTATGAGTGTGTGTGAACTAGTGTGTATGGGTGATTCCCA
GTGATGGGTTACAGCTGGAGGGTGATCCGCTGTGTAAAGC
ATATGCTGGAATAGTTGGCGTGGACACACTATAATCCAAA
CAGCTTGGCACTGTGAAGACACTGTCATTTAAATGGCATC
TATGTCTGTCTCCAGACCACATAATCTTGGACCCGGCCCG
TATCCAGAGCAGGCGGTGGTTATGATGATCGATTAGTCAG
TTTTAATCATCTACACCAGCATCCTACACTCCTCTCCTGC
CTGCCTGAACTGCTGGAATGGTTCACAATATGAAGTATCG
TCATGTCTTCTCTCTACTCTCTGTACTTCACCCATGCTGA
CACAATCTACACAGTCAGAAAGCAGGAAAGAGTGCAGAAG
AGTTCAGCTCAATGTCTGACTGTTGATTCCAAGATCTGTT
GTGTTTAAGATTCAGTCATTCACTCTCCTTCGGCTTAGTC
CCTTTATTCATGAGGGGTCGCCACAGTGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations