Transcript

slc15a5-202

ID
ZDB-TSCRIPT-131113-1008
Name
slc15a5-202
Previous Names
  • ch211-190o6.3-001
  • si:ch211-190o6.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056649 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056649|OTTDARG00000039460|ZDB-GENE-131121-351 si:ch211-190o6.3|OTTDARP00000044433 CH211-190O6.3-001 LG_none CR356235.15,CR376836.6 Danio rerio protein_coding NOVEL, 2048 bp
TTAGTGAGGAGAAGCAGTCCGTAAACATTACCCAGAAACC
TTAGTCAGGAGACGCAACGTGAGCTTTGGCGTGCTTGCAT
GGTTGTTAGGCATCCACAAGATTTCACAGGTTTGTGAGGA
ATTGCCTGACTAGTAAAATGGAGAAGGGGAGTCAGCCTTA
TCTGAGCATCACTTCCAAGGGAAGAACTCTGGAAGCAGCA
TGCTGCCCATAGATGTGTTTGATAGACCTGAACATCTCCT
TCATGGGATCTGCAAGACTTCACATCCCGGGATGTTTAAC
AAGCCACACAAGGGGCGTAAGAAGTTGCAGGTGATTATAT
GTGTGCTTTTCGTGGAGCTTTTCGAGAGGTTCACCTTCTT
TGGGATTGTCTGCAATATGATCCTTTTCTGCACCATCAAG
CTGGGATACAGCAGCTACCAAGCTGCCATGGTGAACACGT
GCTTTGTGGGAGCCTGCATACTTACGCCTGTTCTTGTGGG
ATGGTTTGCTGAGACGTGTTTGGGAAGGACAACGGTTCTC
TGTTTTTGTGCACTTCTTCATTTCATCGGAACCGCTTTGC
TTCCTGTCGTCGCGTTCCCTTTTGAGGATTTCTATATTAA
CACACATAATATAGTGCATCAGCTTGAGCCTCATGAGCAA
CACATACTATTCTACTTGGCACTGATTGCTGTGGCTCTTG
GTATCGGTGGCATTCGAGCAATCCTCTGCCCAATGGCAGC
CTATCACCTTCAAAGTTGTGACCAGCCCAAGCTATTGTCC
TTCTTCAACTGGTTTTACTGGATGGTCAACCTGAACTCGA
CAGTAGTTTTTTTGGGAATTGCCTACATTCAGCAGTCAGT
TGCCAAAAACCTGTGTTTTCTCATCCCTTTCACGTCTGTT
CTCCTCGCCCTCATCGCCTTACACATGGTGCGCAACAAAC
TGACCTTCCGTCCCAAAAAAGGTAGTTCCTTGCTAACTAC
ACTGGGAGTGTTCCTGAATTCTTTCAAAATGTGCTGCCTC
CATTATCGCCATTTGAGTGGAGATGTTGCCAACTGGCTAG
ATCGTGCCAAGGAAAACAATGGAGGTTGTTACAGTGAAAC
CAGTGTGGAAAATGTCAAGATACTGGTCAAACTTTTCCCT
CTCTTTGGACTTCAGCTTTTATATCGAGCTTGCATTACCC
AGATTCCATCAGGCTATTATCTGCAGACCATGCATTCCAA
CCTAAAACTCAATGGCTTTCTCTTGCCTGTAGCAGTGATG
AAGGTCATCAGTATATTGCCGGTGTTGATCTTAGCACCAC
TGCTGGAGCTTCTGAATACCTACTATCAGTCTCCAAAGAA
AAAGCTGCCCTCGCCAGCAACATTCATAACTATGGGTCAT
GGTTGTGCAGCTCTCTCAGCACTGCTAGCAGGAATCTCAG
AGATCCACAGGAAGGATTATCCAGAGGTGGAGCAGACACT
ATCAGGAAAGGTCCTGCAGGTGTCATCAATGACATGTTTC
CAGCTCACGCCCCAGTACATTTTACTGGGAGTGGCAGAGG
CCTTTGTGACTCCAGCATGCTCTCTCATAGCCTTCTGTCT
GACTCCCAGCAATCTTAGAGGCGTCTCTTTGCATTTCCTA
ACCCTCTCGTACGGAGGTGGCTGCTTTCTGGGAGCTTTCC
TCATTCACTTGCTTTATTTTGTGTCAGGAGGAAACTTCTA
CCCTAATAACCTCAGCAGTGGCAACATGGAGAGGTTTTTT
TTTATTCTGGCCACATTGATGGCTATCAACACACTTGTGT
TTTGGAGAATATCACAAAGCAGGTATGCAGATTTGAGCGT
GGAGCTGAGTAGCGGTATAAAAGACAGTCCTCTGTCAGAG
AAACTCCTGCAGTACAAGACCTGTCTGCGCTTTTATGACA
CAATGGAGCGCTCGGACACCTTGACGTCTATGGAAACTGT
TTTGTGAATTCGCTGTATGTAAAAACTCTGTAATGCTGGC
GTTACATGAGATTTAATCTGAATGAGTTTCATTGCTTGAG
CAATAGCTGTAAATAATGCTATTTAAATGTTTTCAAATAA
AACGTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations