Transcript

man2c1-201

ID
ZDB-TSCRIPT-131113-1003
Name
man2c1-201
Previous Names
  • man2c1-001
  • dkeyp-73b11.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056628 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056628|OTTDARG00000039447|ZDB-GENE-101103-4 man2c1|OTTDARP00000044412 DKEYP-73B11.10-001 LG_ CR391977.5 Danio rerio protein_coding NOVEL, 4724 bp
TGAATGAATGGTCTGTTTGCTGACTGATTGAATGATGCTG
AAAAGCTGTTAGAGGCCTCTGATTCACTTCTGCAGCTGTA
TAACTGCGAGCAATACCTTTTTCAAATGAAAATATAATTT
CATTTGATTTACCTTCAGCTAACTGACCCAGCCGAGTCTC
GAACCATTCATTCTTGCTGTGAGTGCTAACCACTGAGCCA
CTATGTCACCTCAGATGAAAATGTAAATAGAATTGACAAC
TAATATGATTTTGTGTGTTAGCTAAAGGACATAGATGAAA
ACTTAATTTTTGTGCTGTTTTTGCGTACAGTGTTCCACTG
TGTTGTGATATTTCTGTGCATTAAATTAACAAAGCAAAAA
ACAACAACATTTGTTCATTTTAAAAGCTACAGATTTCATA
GGTAGGCTACAAGAAATGGTAAAATTAAAATAACTGCACA
TATATGAATGTCAAATATCATCAATTTTAATCCTATAGTT
TCATGGAGTTGGACACAGAAGTTATCGGACTTTACAAATT
TATTGCTGGTGATATGTTTCATTTGCTGTTTTTATTGTAG
GCAAATAAATTGGCATGTCATATTTATTGTTCGCATAATA
ATAATACTTATGGTGATGGAGCTATATTTTTACAAGCGCC
CTGTCGATGTGAAACATGATGCAACGGCGTCCTCTGGTGT
TCATTAGTCGCAAAATCGCATGGTGTGCATTTGAAGTTCC
TTGTTTTTGTATATGTACTTCCGGGTTCTTGCACAAACAC
GTCTTGGGCTTATTGGATTCATAACTACGCTACTTTTGAA
AAATGTACCACCAACCCGTACTGAAAAACAGACGGACTCT
GCTGGAGCGTGTGGAAAAGTTTATTTCTGATATATATTTC
ACAGACTGCAACCTTAGAGGAAGACTGTTTGGAGACATTT
ACCCTCTTGAATCCATCTCTGTGTTCTTGTCAGAGAAGCG
CATTCCTTATTCAGAGGCAATTCAACAAAACTTTCAGCCT
TGTAAAGTTGGTGATTCATTTGGACCCACCTGGTGGACAT
GCTGGTTCAAAGTAAACTTGAAGATCCCAGAGACTTGGGG
AGGGAAGGAAGTCCACTTAAGATGGGAAAGTGATGGAGAA
GGAATGGTATGGCAGAATCAACAACCAGTTCAGGGATTGA
CCAATGAAGGTGAGAAGACAAGTTACATTCTGACTGAGTG
CTTGAAGGACAGTGAATCTCATGGAATTACTCTATATGTG
GAACTTGCATGTAATGGACTTTTTGGAGCTGGACAAGGTT
CCATGATTGCCGCCCCTGACCCAAACAGAAAGTTCACTCT
ACAGAAGGCAGAGCTTGTTGTATTCAATCGAGATGTCATG
GAACTTCTAACTGATTTTGAGATGCTTCTGGACATGGTCA
AGGTACTAGGAGAAGGAGAGCAACGTGGGTTTCAGGCTTT
GTTTACAGCCAATGAAATGGTGAATCTGTGTGATCCAGCC
AATCCTGGTTCATTTGCTGCTGCTCGAAGTCTAGCTCAGA
AGTTTTTTGCCCAGAAAAATGGGGAAAGCCAACATGTGGT
ACATGCTATGGGACACTGCCATATTGATTCAGCTTGGTTG
TGGCCATATGAAGAGACCATCAGGAAGTGTGCTCGCAGCT
GGGTCACTGTTATCAGACTGATGGAAAAGAACCCAGAGTT
TGTCTTCACATGCTCCCAAGCACAGCAGTTTCAGTGGGTG
AAGAGCTGGTACCCGGGCCTGTTCTCAGAGATCAAGCACT
TTATACAGAAAGGCCAGTTTATTCCAGTTGGAGGCACTTG
GGTAGAGATGGATGGTAACTTGCCATCTGGTGAGTCCATG
GTCAGACAGTTTCTACATGGCCAGAACTTCTTCAAGGACG
AATTTGGAAATTACTGTAAAGAGTTTTGGCTACCAGATAC
ATTTGGTTACTCTGCACAGCTGCCTCAGATCATGAAAGGG
TGTGGGATCTCTCGTTTTATTACTCAGAAGCTGAGCTGGA
ACCTTATTAACACATTTCCACACAACACATTCTTTTGGGA
GGGTATTGACGGGACAGCAGTTCTCACTCATTTTCCTCCA
GGTAACTCTTATGAGATGAAGGGTAAAGTGGAAGACTTGA
TTAACACGGTGAAAAACAACAAAGACAAGGGACGAGCAAA
TCATAGTGCATTATTGTTTGGTTTTGGAGACGGTGGTGGT
GGACCAACACAGCTAATGTTAGACCGACTACACCGTGTCA
AGGATACAGATTGTCTGCCTAAGGTTCAGATGTCAACTCC
TGATGTCCTGTTTTCTCACCTGGAATCAGACTCATCGCTC
CTTTGTAGATGGGTTGGTGAGCTCTTCCTTGAGCTACACA
ATGGCACTTACACTACACAAGCAAAGATCAAGATGAAAAA
TCGACAATGTGAAACACTGCTTCATGATGTTGAGGTGGCA
AGCTGTTTGGCCTTGTCTAAAAAGGATAGTTTCAAATACC
CAGCATGCAGACTTCAGGAACTGTGGAGACTGCTTCTACT
CAACCAGTTCCATGACGTGATTCCTGGCAGCTGTATTGGG
ATGGTTGTCGAGGATGCATTACAGTACTATGACGAAATAC
ACACCACGGCATCCAGACTTCTTCTTGATGCTTGCAAATC
ACTGCCGTCCTCTCCTGACAATGGTATTGCTGTGCTGAAC
ACTTTATCTTGGGAGAGAACTGAAGTCATATCACTACCAA
TGAAGGACACAGAAACAAGATTAGCCTTGGTGAGAGTCCC
TAGCGTGGGTGTAGCTCATGTCAAGGAGACAGCAGAGTCT
GCTGAGTCTGTTATTGCCACAATGATGGTCAATGGAACCA
TCATTATGGAAAACGGTCTTTTGAAGGCAACTATAGACCA
TCTAGGCCGTTTGATGTCACTGCTTTTAATCCAAACAAAC
AGGGAAACCATTTCCGAGGGTTGCTTTGGGAATCAGTTTG
CATTGTTTGATGATGTACCTTTGTATTGGGATGCTTGGGA
TGTGATGGACTACCATCTTCAAACAAGGAAGCCTGTAATT
GAGGTCATTGAACCTGCCAAGGTGCTAAAATCAGGAGGAA
TTCAGGCCAGTGTCTCTTTCTCACTAAGGATTAACGGAAA
AAGCACTATTCAACAGGAGATTGTTCTAGATGCCTGCTGT
CCCTATATCAAATTCAAAACACATGTGGTCTGGGAAGAGG
CGCATAAGTTTCTAAAGGTAGAGTTCCCTGTGCAGGTGCG
CAGCCCAGAGGCTACCTACGAGATACAGTTTGGACACTTG
CAGAGGCCTACTCATAGAAATACCTCCTGGGACTGGGCTC
GTTTTGAGGTGTGGGGACACAAGTGGGCTGATCTGTCCGA
GCATGGTTTTGGCGTGGCTCTTCTTAACGACTCCAAATAT
GGCTACTCTGTCCATCAAAACATCATGACCTTGTCCCTTT
TGCGGGCTCCAAAAGCTCCAGATCTCAATGCTGATATGGG
GGATCATATTTTTAGCTATGCGTTGATGCCACATACAGGC
ACCTTTCAGGAATCTGCAGTTATCCAGTATGCCTACAACT
TTAACTACCCGCTTCGTGTCCATCATGGTGTCATTCCTAA
ACCCTGGAGTGCATTCTCCGTAAGCTCACCTGCTATCATC
CTGGAAACCATAAAAAAGGCGGAAAAAAGAGAGAATGCCC
TTCTTATTCGCCTCTATGAGTCTCACGGAAGCCGTGTGAC
TGTGACATTGTCAACTTCCTTTCTTTTACAAGAAGTCTGG
CATTGTGATCTCTTGGAGCGTCCAGATTTCAGAATTCCTG
TGTCAGAGACAACCTCTGGAATATCCTTAACATTCAAACC
ATTTCAAATCAGATCTCTCCTCTTGATTATACAGTAAACC
ATTTAATTGCATGCTGATTATGATGCAGGTACTTAAACAA
CTTGATTAAAATCCCTAAGTAGATTTTCATTTTGGAAAAT
TAGTGCTTTATTATTTGTATGTTTTTTTTTTTTTCATGTA
AAATTACATTTGATTTATGATGCATTATGTGGGTCATTAA
CTCTTTATTGGTGAAATATTAATATACCTTGGCAAAGCTG
AATAATAAGAGTTCAGTACACAGTAATGACATACTACAAG
TCTGAAACACAGTTGTTTATTTATTCTCATGTGATTCCCC
CTGGAGTGGAAAATCCCAGTGGAAAATGAGCCAATCCAAA
GCACTGATTTTGATATTACTCATGGGATCTTACATATAAA
TGAACATGGGCATAGGTATTTTACTGACTGATTTCATTGG
ATATTTATTTTAGGAAATTTTTGTTTCAGACAAAGTTTGA
GATTTTTTTTTTTCAATAATGCATTGTGTTTAACTTGTTT
GTGACAACAGCAAATAAATAAATAAAAATCTGACCAGAGG
GGTATTGCATAAAAGTAAGATAAGGGATTATGCTGGGATT
TTGAGACTATTGTGGTTTAATTTTTCATAAGTCTTATAAT
TTTTGCTAAATTTATTTTGCTGCAAGCCTGCTCCAGAGCA
GGCTAACAACCAGGCTAAGGATTTATATGTTAGTTTCGTC
AGTGCTACAAAAAATTTAAGTGTTTTACAGTCACTCTGTG
CACTTCACAAATATTTTCTATCTATTAGTATTAAAAATGT
TTAGATTTATTAGCAATCATTTTATGTATGTTCATATACA
GTTGAAGACAGAATTATTAGCCCCCCTGAATTATTAGCCC
CCCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations