Transcript

si:dkeyp-73b11.8-201

ID
ZDB-TSCRIPT-131113-1001
Name
si:dkeyp-73b11.8-201
Previous Names
  • dkeyp-73b11.8-001
  • si:dkeyp-73b11.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056622 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056622|OTTDARG00000039444|ZDB-GENE-131120-176 si:dkeyp-73b11.8|OTTDARP00000044410 DKEYP-73B11.8-001 LG_ CR391977.5 Danio rerio protein_coding NOVEL, 979 bp
CCTTCACCTTCACCAGTGTTCACACAACAGTGGTTCACTA
TGAGGGAGCTTGGCATAATTTTATTCATTTTTGCTCTGAA
CCACAACATTCAGGCCCAAACACGAAAGCCAGAGGCCTGC
ACTCTCAAACAAGATGAAGGGACAGGAAACGACGTTGTGG
TTTATATGTATTATGATGCAGATAAAGACAGCTGTTATCC
TTTTCGATACAATGGCGAGGGTGGCAATTCAAACCGTTTC
ATAACTGAGAAGCAGTGCATGAGAAACTGTTCACACCGAG
CTGATCAGCTGTTCCCTATGGATGGAAAACAGATTTGCGT
GCTTCCCAGAGAGCCAGGACAATGTTTCGGTCACTATCTT
CGGTATTACTACAGCCCCGAGCATCACACATGCAAGCCGT
TCTATTGGACTGGTTGTGTGGGCAATGGAAACCGATTCCT
ATCACTTAATCGTTGCAATGCCACTTGTTACAACTCAGCA
GATAAAGGCCATGAGGACCATTCAGGTGAATCTGATGTAC
CTGTTGGAATTATCCTGGGTGTAGTGTTCGGTCTAATTGG
TGCCATTATTCTCATTGTGGTGATCGTCTTTGCTGTCAAG
AAGCCTAGCTCAAAGAAACGTGAGAAAAAAGATGGAAAGT
CAACAGAGCAACCACTAAGGGAGCAGGCAGTTGAGATGGA
AGGAGGGGAAGCACAGCCAGCCACTCTTGAAATCTCTACA
ATCCAAACTTAAAAATCGTTGAACTCACATTTGTACATTG
AACACTCAGGCCGATCATTGTTTACTTTTGTAGAAGAGGT
TAATTTGACAAATAAAAAAAAGTACAAAATATGTGTGTTG
CTTATTTGCTTTATTCTTTTTTCCACTATATATTTTTTTA
TCTTTCTAATTTACGTTGTAATATATGTCTGCCATATTAA
AATACACAATGCATAAAAAATGTCTGTAAGGTATTAAATT
GTTTGAATTATAAAACTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations