ZFIN ID: ZDB-TSCRIPT-131113-1001
Transcript Name: si:dkeyp-73b11.8-201
Previous Names: dkeyp-73b11.8-001, si:dkeyp-73b11.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056622 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056622|OTTDARG00000039444|ZDB-GENE-131120-176 si:dkeyp-73b11.8|OTTDARP00000044410 DKEYP-73B11.8-001 LG_ CR391977.5 Danio rerio protein_coding NOVEL, 979 bp
CCTTCACCTTCACCAGTGTTCACACAACAGTGGTTCACTA
TGAGGGAGCTTGGCATAATTTTATTCATTTTTGCTCTGAA
CCACAACATTCAGGCCCAAACACGAAAGCCAGAGGCCTGC
ACTCTCAAACAAGATGAAGGGACAGGAAACGACGTTGTGG
TTTATATGTATTATGATGCAGATAAAGACAGCTGTTATCC
TTTTCGATACAATGGCGAGGGTGGCAATTCAAACCGTTTC
ATAACTGAGAAGCAGTGCATGAGAAACTGTTCACACCGAG
CTGATCAGCTGTTCCCTATGGATGGAAAACAGATTTGCGT
GCTTCCCAGAGAGCCAGGACAATGTTTCGGTCACTATCTT
CGGTATTACTACAGCCCCGAGCATCACACATGCAAGCCGT
TCTATTGGACTGGTTGTGTGGGCAATGGAAACCGATTCCT
ATCACTTAATCGTTGCAATGCCACTTGTTACAACTCAGCA
GATAAAGGCCATGAGGACCATTCAGGTGAATCTGATGTAC
CTGTTGGAATTATCCTGGGTGTAGTGTTCGGTCTAATTGG
TGCCATTATTCTCATTGTGGTGATCGTCTTTGCTGTCAAG
AAGCCTAGCTCAAAGAAACGTGAGAAAAAAGATGGAAAGT
CAACAGAGCAACCACTAAGGGAGCAGGCAGTTGAGATGGA
AGGAGGGGAAGCACAGCCAGCCACTCTTGAAATCTCTACA
ATCCAAACTTAAAAATCGTTGAACTCACATTTGTACATTG
AACACTCAGGCCGATCATTGTTTACTTTTGTAGAAGAGGT
TAATTTGACAAATAAAAAAAAGTACAAAATATGTGTGTTG
CTTATTTGCTTTATTCTTTTTTCCACTATATATTTTTTTA
TCTTTCTAATTTACGTTGTAATATATGTCTGCCATATTAA
AATACACAATGCATAAAAAATGTCTGTAAGGTATTAAATT
GTTTGAATTATAAAACTGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-73b11.8-201 Contained in:
[BAC] DKEYP-73B11 (1)

Genome Resources: Vega_Trans:OTTDART00000056622 (1),  Ensembl_Trans:ENSDART00000123004 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH489628 (1) 998 nt
GenBank:EH515987 (1) 846 nt
GenBank:EH534175 (1) 820 nt
CITATIONS (2)