ZFIN ID: ZDB-TSCRIPT-130528-9
Transcript Name: si:dkey-66i24.10-001
Previous Name: dkey-66i24.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049862 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049862|OTTDARG00000035079|ZDB-GENE-130603-25 si:dkey-66i24.10|no_translation DKEY-66I24.10-001 LG_ BX004999.8 Danio rerio antisense NOVEL, 3588 bp
CAAGAAACGACTGGTTCACAGTGACAAAACAGCAGGGGAA
CATATAGATTACTGTCGTTTTCTGGATTTTGTTCGTGTGT
AGACAGTCTTTGTTTGTTCTATGATGAAAGTAATCTGCAA
ATGACTTCGAGCGAAGAGCGCCTGTGCAGACCGCGCGGAA
GAGGCGAGCGGCCAATGCACCGGAGCACCCTGACTCTCGG
CGACCGCAACACATGCTTTTACTCTACAACACATACAGAG
AGTTTTTCTAGAAGAGGACATGATGGTCAAGCACTGATCT
TTCCACACCGAAATCCATGTTATCCCTCTCAGCATAATGG
AAAGCTGGACCTCAAAAACATCCCTGTGACACAAGGACAG
ACACACTCCAGAGATGAATATGGCCCAAAGAGATCATACC
ACATTACGTCCTACATCAAGCAGGGCTACGGAACAGAAGA
CAGAACCGCCAGGGCTTTGTGATGAAAGAAGTCACCAACC
CCACTGAGCCCACACCATACCAGAGCACATATCACACAGC
ACACTGCAGCAGATACCAAACAAATGAAGACACCAGTGGA
CGGCCAGTCTATTGGCACAGCCATAACATTATCACAGGAC
AGGAGGAGGCTGCAGCTGGGCCTGGGAGACCCAGAAGACA
GTCTGGCGAGAGTGTTTTGTGGGAAGCTCGACGTTGGGAG
ACACATCACGACTCGTTACGTTTGTACTAAACTGCTCAAC
TGCAACATGAGACCAGTAAACAGTTAATAAATGTTCTCTA
TTATGCTGGTTAGCAGTCAAATATTACGAACAAACCTTCA
AAATTAGGTCTCTGTGGAGAAAAAAAAAAAACATTTAAAA
TAAGCATGAGCAAATAATTGGTTTGTTACATTTCTATAAA
TTATATAAAAATTAAATTTGGGTTATTTTTATTTATTTTA
GTATGATTTATACACCGAATGAGCCACAACATATGACCAC
ATACCTAATATGATGTTGGTCCTCTATAAGTTTCTAAAAC
AGTCCCAAACACCGGCAAGACCCCTGAAGATAGTCCTTTC
ATAGTTGGCACCAAGAAACTGACAGCAGATCCTTCAAGTT
CTGCGAGTATTGAGGTGAACATTTTTGAGGTTGATTTGTT
GGGTTAATAAACCCCACACACAGATTCTCAATTGGAGTGA
GATCTGGTGAATTTGGAGGCCAGGGAAACATCTTGAACTC
TTGTGTTCTTCAAAGGGTTCCCACTTTCATGAAGGGCAGA
TTCAAGGACTAACATTTGAAATCAAGTACCATTGTAATTT
ACACCCCCAGTAAGTGTAGTGCCATGTATGTCCTTACCGT
TCTTAACATTTCACTTACACTTAATTTAAATGTGGGTAGG
TTTTCCAGAGATGTTTGTCGTTCAAAAGCAGCAGTTTCCT
AAATGTTGATCAAATTTGCGTTACTAGTCGTAGTTCTTGT
ACAGGATTTAAATTGTAAGATTTATGAATTAAGATTTTTT
TTTTTTACAGCAGCACAGTACAATTGTTGAACTAACACTA
TCAACACATTTAATTTTAAATTTAATTCAAGCACTTTTAA
GGACCTGTGTGTTTAAGCACTTTCCAGGCCTTGAGATCCT
ATGTTTGAAATTCAAATACTAAAGTGTAGGAAATGGAAAC
CCAGTCTTCAACCCTTCCTCTGGGAAACCCCATTACCATT
ATGATCTTAAAAATGTTTAGTGGGTAGCAAGTGTGATATT
TTCGTCTCCAACACCCTGAACATCACAATCCCTCCACTAC
GTACCATTATCCTTCAGTGCATGTTGGTGTATTACCTCCG
ATATTTCTTTGGCATTTTAGAATGACCAAAACAACATTTC
AGATATTTTACAATGTGTTCAGCTTGCTGGTTTATCCATT
CACACACATTTTTTAATCACCACATAATCTTTTTTTTATT
GTGCATACTGGAATTTGTTCAGTAAAAGTGTTACCATCAT
AGTTTATGCGCATCTTTTCTTATCACATAAAAAGTTTATT
CTACTCAATTTTCAACATTTATGCGCATCTTGCCGTTTGC
ATCAACTGTTTTATCATGTGCATGTCCAAAATGCATGTGA
AATAGGTGGATGGACACATAGCTACTCTCACCTACCCACA
CTTTAACATGTGCTATTGTTAGGAGGTAATATAATATTCA
CCTCACCTGTGTCAATATTTGAGCTCATCATTGTATATTG
CGTTTCCACTTGCACCACAATATTTGTCAGTTACCCATAT
GCCCGACCATTATAAACATACTCGGTAAGTAAACAGCATC
ATGCATTGCGTGATAAACTACTAAGCGTTGTTCTGCCTAC
TTATGCCATCTAAACTATAGAAAATGTGCATTTTACTCCA
CTAAATCTTGTAGGAGGAAGCAGGAAAAATTGTACTAGCT
TGACAAACTGAATAAAAAGGCTCTATTCTGATTGATTTGT
GATAATTTTGTCTTTAGTACTCTAAAAATGTCTTTATTTT
CCCTATTTGACTTAATACAGGCCGAAACATGACAATAATT
GCATTTAAAAAAAAAAATACTGCTGTTGCAAATGATCAAG
TTTAATTTGATAGGGACATTTTTTACGTTGTGCTCTCCAA
CATGTCTTACTGATGGTACGTCAGGAAAACCAGCTATACT
GTTATTAGATTTCGAAAATGTGCTTTTTCATAATTATGTT
TCTGAAACCTTTAGTTCATTGAAATATTTACATTTTGTTT
TATTTCAATTATAGTACTTTGATATTTGCTAAAACAACCT
CAAAGTTTCACCTCTAATATTTAAACATTTATCATCTATT
GTTTTTAATAACTTCACAGATTTGGTTACAAAATCTAGTT
TCAAATCAGTTTAATGCTTTAAAGAACACAAACAAAACGA
CAGGTAAAATGACATGGAGAGAAGACAAACTTAAGACAAG
CTGATAGAACACACAACAGAGAGGAAATGAACGTGTATAA
ATATATACACACACACGCGCACACTCACACACACACACAA
CGAGAGGTTTTCAATTGGAAAATGGCTAGAGCTAGAGGAC
AGTAATGAGGGTCCACACAGCACTAGTACAGCAGTATGGG
TCTAACGTCCCCTTCACAAACACTCCAGTTCAGGTTTTCC
AGTGCAATTTTCAGAACAGTGCAGAAATGCATGTTTCCAA
GCCATTCATAGACAAAAAGGCTACATTTCATGAATTCTGA
TGATGTGTTCTGTGCATCTAATTGGTTAAAGCAAATATTG
GGCAGATGCCTTGCAAATTTAACAGATTCAAAGAAATTAA
GCGCTCTATATTTTGCACAGACTTATTAAATGTGCTATGA
CATGCAAATATACATGACTGTAAGAGCTGAAATGAGTATT
TCAGCATTGAAAAAATAAAACACTTTTGATGGAAAACAAA
TGTATACTTCAAACTGAAACCTAAAAACAAAGTTATACGT
GAACCTTAAGAGATCTCTGCATACATTTAAGCTGTTCTCT
AGATGTTACTTATCACTATCAGCTTAGTTTCTGCAAAAGC
TTTACGTTGGTCTGTGGAAATTTGACGATAAGCAGGGAAG
ATGACCACATTAAACTCAAATTTGTCTG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-66i24.10-001 Contained in:
[BAC] DKEY-66I24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049862 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO354205 (1) 710 nt
GenBank:BQ419660 (1) 576 nt
GenBank:EV563281 (1) 525 nt
GenBank:CO355910 (1) 520 nt
CITATIONS (1)