header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-698
Transcript Name: batf-201
Previous Name: batf-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058756 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058756|OTTDARG00000006383|ZDB-GENE-041014-291 batf|OTTDARP00000045894 batf-002 LG_ AL929435.16 Danio rerio protein_coding KNOWN, 577 bp
GAGGATCGCGATCACTTCACATGCAGTCTCATAAAGTCTG
AGACGCTGAGAGAAACACACACAAGACGCTGAAGGAGGTC
AGAGAGTTCGCAGGGACTGAAGTGGCATGGCTCAGGGCTC
TGACAATAACGACACCAGCTATACCAAATCACCCTCACCG
GGCAATAAACAGGGTTCATCAGACGACATGAGGAAAGTCA
TGAGGAGAGAAAAGAACCGCATCGCGGCGCAGAAGAGCCG
AATGAGACAAACACAGAAAGCTGACAGTCTACATCTGGAG
AGTGAAAGCTTGGAGAAGGAAAACGCAGCGCTCAGGAAAG
AGGTGAAGAGACTCACAGAAGAGGCCAAATATCTGTCTAC
CGTCCTGAGCAACCATGAGCCGCTGTGCACGGGCCTGAGC
GGCGCGTCCCCGGAGCTGCTGTATGGCGCGCACCACGGAG
CGTTCCACCAGCACATCAGCGTGCCGCACTACCCACTCTG
ACCGCCAGAGGCCGCCGGAGTCCCGCACAGAACCCGCCCG
GTCCCGTCAATGAACTTTGGTTGAGTTAAAAACCACGTAC
ATAGTCATCATCATCAG

batf TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA batf-201 577
batf-202 (1)    Ensembl 637
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
batf-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058756 (1),  Ensembl_Trans:ENSDART00000005548 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB987294 (1) 570 bp
GenBank:EB990003 (1) 551 bp
CITATIONS (2)